Sequence Alignments Introduction to Bioinformatics.

Slides:



Advertisements
Similar presentations
Sequence Alignments.
Advertisements

Alignment methods Introduction to global and local sequence alignment methods Global : Needleman-Wunch Local : Smith-Waterman Database Search BLAST FASTA.
Sources Page & Holmes Vladimir Likic presentation: 20show.pdf
Lecture 8 Alignment of pairs of sequence Local and global alignment
Definitions Optimal alignment - one that exhibits the most correspondences. It is the alignment with the highest score. May or may not be biologically.
Sequence Alignments and Database Searches Introduction to Bioinformatics.
C E N T R F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U E Alignments 1 Sequence Analysis.
1-month Practical Course Genome Analysis (Integrative Bioinformatics & Genomics) Lecture 3: Pair-wise alignment Centre for Integrative Bioinformatics VU.
Sequencing and Sequence Alignment
Developing Pairwise Sequence Alignment Algorithms Dr. Nancy Warter-Perez.
Developing Pairwise Sequence Alignment Algorithms Dr. Nancy Warter-Perez June 23, 2005.
Introduction to Bioinformatics Algorithms Sequence Alignment.
Summer Bioinformatics Workshop 2008 Sequence Alignments Chi-Cheng Lin, Ph.D. Associate Professor Department of Computer Science Winona State University.
Alignment methods and database searching April 14, 2005 Quiz#1 today Learning objectives- Finish Dotter Program analysis. Understand how to use the program.
C T C G T A GTCTGTCT Find the Best Alignment For These Two Sequences Score: Match = 1 Mismatch = 0 Gap = -1.
Introduction to Bioinformatics
Sequence Alignments Chi-Cheng Lin, Ph.D. Associate Professor Department of Computer Science Winona State University – Rochester Center
Developing Pairwise Sequence Alignment Algorithms Dr. Nancy Warter-Perez June 23, 2004.
Alignment methods June 26, 2007 Learning objectives- Understand how Global alignment program works. Understand how Local alignment program works.
Pairwise Alignment Global & local alignment Anders Gorm Pedersen Molecular Evolution Group Center for Biological Sequence Analysis.
Sequence Alignment Oct 9, 2002 Joon Lee Genomics & Computational Biology.
Developing Pairwise Sequence Alignment Algorithms Dr. Nancy Warter-Perez May 20, 2003.
Introduction to Bioinformatics Algorithms Sequence Alignment.
Bioinformatics Unit 1: Data Bases and Alignments Lecture 3: “Homology” Searches and Sequence Alignments (cont.) The Mechanics of Alignments.
Alignment II Dynamic Programming
Developing Pairwise Sequence Alignment Algorithms Dr. Nancy Warter-Perez May 10, 2005.
Pairwise alignment Computational Genomics and Proteomics.
Roadmap The topics:  basic concepts of molecular biology  more on Perl  overview of the field  biological databases and database searching  sequence.
Alignment methods II April 24, 2007 Learning objectives- 1) Understand how Global alignment program works using the longest common subsequence method.
Sequence comparison: Local alignment
1 Introduction to Bioinformatics 2 Introduction to Bioinformatics. LECTURE 3: SEQUENCE ALIGNMENT * Chapter 3: All in the family.
Sequencing a genome and Basic Sequence Alignment
Developing Pairwise Sequence Alignment Algorithms
Sequence Alignments and Dynamic Programming BIO/CS 471 – Algorithms for Bioinformatics.
Sequence Alignment.
Pair-wise Sequence Alignment Introduction to bioinformatics 2007 Lecture 5 C E N T R F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U E.
Pairwise alignments Introduction Introduction Why do alignments? Why do alignments? Definitions Definitions Scoring alignments Scoring alignments Alignment.
Pairwise & Multiple sequence alignments
CISC667, S07, Lec5, Liao CISC 667 Intro to Bioinformatics (Spring 2007) Pairwise sequence alignment Needleman-Wunsch (global alignment)
Evolution and Scoring Rules Example Score = 5 x (# matches) + (-4) x (# mismatches) + + (-7) x (total length of all gaps) Example Score = 5 x (# matches)
Content of the previous class Introduction The evolutionary basis of sequence alignment The Modular Nature of proteins.
Alignment methods April 26, 2011 Return Quiz 1 today Return homework #4 today. Next homework due Tues, May 3 Learning objectives- Understand the Smith-Waterman.
Pairwise Sequence Alignment. The most important class of bioinformatics tools – pairwise alignment of DNA and protein seqs. alignment 1alignment 2 Seq.
Pairwise Sequence Alignment (II) (Lecture for CS498-CXZ Algorithms in Bioinformatics) Sept. 27, 2005 ChengXiang Zhai Department of Computer Science University.
Pairwise Sequence Alignment BMI/CS 776 Mark Craven January 2002.
Pairwise alignment of DNA/protein sequences I519 Introduction to Bioinformatics, Fall 2012.
Sequence Analysis CSC 487/687 Introduction to computing for Bioinformatics.
Click to edit Master subtitle style 12/22/10 Analyzing Sequences.
Sequencing a genome and Basic Sequence Alignment
Construction of Substitution Matrices
Sequence Alignment Csc 487/687 Computing for bioinformatics.
Function preserves sequences Christophe Roos - MediCel ltd Similarity is a tool in understanding the information in a sequence.
Arun Goja MITCON BIOPHARMA
Applied Bioinformatics Week 3. Theory I Similarity Dot plot.
Sequence Alignments with Indels Evolution produces insertions and deletions (indels) – In addition to substitutions Good example: MHHNALQRRTVWVNAY MHHALQRRTVWVNAY-
Pairwise sequence alignment Lecture 02. Overview  Sequence comparison lies at the heart of bioinformatics analysis.  It is the first step towards structural.
Sequence Alignment.
Construction of Substitution matrices
Sequence Alignment Abhishek Niroula Department of Experimental Medical Science Lund University
Techniques for Protein Sequence Alignment and Database Searching G P S Raghava Scientist & Head Bioinformatics Centre, Institute of Microbial Technology,
Last lecture summary. Sequence alignment What is sequence alignment Three flavors of sequence alignment Point mutations, indels.
INTRODUCTION TO BIOINFORMATICS
Sequence comparison: Local alignment
Biology 162 Computational Genetics Todd Vision Fall Aug 2004
Pairwise sequence Alignment.
Intro to Alignment Algorithms: Global and Local
Pairwise Sequence Alignment
BCB 444/544 Lecture 7 #7_Sept5 Global vs Local Alignment
Pairwise Alignment Global & local alignment
Presentation transcript:

Sequence Alignments Introduction to Bioinformatics

Intro to Bioinformatics – Sequence Alignment2 Sequence Alignments  Cornerstone of bioinformatics  What is a sequence? Nucleotide sequence Amino acid sequence  Pairwise and multiple sequence alignments We will focus on pairwise alignments  What alignments can help Determine function of a newly discovered gene sequence Determine evolutionary relationships among genes, proteins, and species Predicting structure and function of protein Acknowledgement: This notes is adapted from lecture notes of both Wright State University’s Bioinformatics Program and Professor Laurie Heyer of Davidson College with permission.

Intro to Bioinformatics – Sequence Alignment3 DNA Replication  Prior to cell division, all the genetic instructions must be “copied” so that each new cell will have a complete set  DNA polymerase is the enzyme that copies DNA Reads the old strand in the 3´ to 5´ direction

Intro to Bioinformatics – Sequence Alignment4 Over time, genes accumulate mutations  Environmental factors Radiation Oxidation  Mistakes in replication or repair  Deletions, Duplications  Insertions, Inversions  Translocations  Point mutations

Intro to Bioinformatics – Sequence Alignment5  Codon deletion: ACG ATA GCG TAT GTA TAG CCG… Effect depends on the protein, position, etc. Almost always deleterious Sometimes lethal  Frame shift mutation: ACG ATA GCG TAT GTA TAG CCG… ACG ATA GCG ATG TAT AGC CG?… Almost always lethal Deletions

Intro to Bioinformatics – Sequence Alignment6 Indels  Comparing two genes it is generally impossible to tell if an indel is an insertion in one gene, or a deletion in another, unless ancestry is known: ACGTCTGATACGCCGTATCGTCTATCT ACGTCTGAT---CCGTATCGTCTATCT

Intro to Bioinformatics – Sequence Alignment7 The Genetic Code Substitutions Substitutions are mutations accepted by natural selection. Synonymous: CGC  CGA Non-synonymous: GAU  GAA

Intro to Bioinformatics – Sequence Alignment8 Comparing Two Sequences  Point mutations, easy: ACGTCTGATACGCCGTATAGTCTATCT ACGTCTGATTCGCCCTATCGTCTATCT  Indels are difficult, must align sequences: ACGTCTGATACGCCGTATAGTCTATCT CTGATTCGCATCGTCTATCT ACGTCTGATACGCCGTATAGTCTATCT ----CTGATTCGC---ATCGTCTATCT

Intro to Bioinformatics – Sequence Alignment9 Why Align Sequences?  The draft human genome is available  Automated gene finding is possible  Gene: AGTACGTATCGTATAGCGTAA What does it do?What does it do?  One approach: Is there a similar gene in another species? Align sequences with known genes Find the gene with the “best” match

Intro to Bioinformatics – Sequence Alignment10 Gaps or No Gaps  Examples

Intro to Bioinformatics – Sequence Alignment11 Scoring a Sequence Alignment  Match score:+1  Mismatch score:+0  Gap penalty:–1 ACGTCTGATACGCCGTATAGTCTATCT ||||| ||| || |||||||| ----CTGATTCGC---ATCGTCTATCT  Matches: 18 × (+1)  Mismatches: 2 × 0  Gaps: 7 × (– 1) Score = +11

Intro to Bioinformatics – Sequence Alignment12 Origination and Length Penalties  We want to find alignments that are evolutionarily likely.  Which of the following alignments seems more likely to you? ACGTCTGATACGCCGTATAGTCTATCT ACGTCTGAT ATAGTCTATCT ACGTCTGATACGCCGTATAGTCTATCT AC-T-TGA--CG-CGT-TA-TCTATCT  We can achieve this by penalizing more for a new gap, than for extending an existing gap  

Intro to Bioinformatics – Sequence Alignment13 Scoring a Sequence Alignment (2)  Match/mismatch score:+1/+0  Origination/length penalty:–2/–1 ACGTCTGATACGCCGTATAGTCTATCT ||||| ||| || |||||||| ----CTGATTCGC---ATCGTCTATCT  Matches: 18 × (+1)  Mismatches: 2 × 0  Origination: 2 × (–2)  Length: 7 × (–1) Score = +7

Intro to Bioinformatics – Sequence Alignment14 How can we find an optimal alignment?  Finding the alignment is computationally hard: ACGTCTGATACGCCGTATAGTCTATCT CTGAT---TCG-CATCGTC--T-ATCT  C(27,7) gap positions = ~888,000 possibilities  It’s possible, as long as we don’t repeat our work!  Dynamic programming: The Needleman & Wunsch algorithm

Intro to Bioinformatics – Sequence Alignment15 Dynamic Programming  Technique of solving optimization problems Find and memorize solutions for subproblems Use those solutions to build solutions for larger subproblems Continue until the final solution is found  Recursive computation of cost function in a non-recursive fashion

Intro to Bioinformatics – Sequence Alignment16 Global Sequence Alignment  Needleman-Wunsch algorithm  Suppose we are aligning: A with A … D i,j = max{ D i-1,j + d(A i, –), D i,j-1 + d(–, B j ), D i-1,j-1 + d(A i, B j ) } i-1 j-1 j i

Intro to Bioinformatics – Sequence Alignment17 Dynamic Programming (DP) Concept  Suppose we are aligning: CACGA CCGA

Intro to Bioinformatics – Sequence Alignment18 DP – Recursion Perspective  Suppose we are aligning: ACTCG ACAGTAG  Last position choices: G+1ACTC GACAGTA G-1ACTC -ACAGTAG --1ACTCG GACAGTA

Intro to Bioinformatics – Sequence Alignment19 What is the optimal alignment?  ACTCG ACAGTAG  Match: +1  Mismatch: 0  Gap: –1

Intro to Bioinformatics – Sequence Alignment20 Needleman-Wunsch: Step 1  Each sequence along one axis  Mismatch penalty multiples in first row/column  0 in [1,1] (or [0,0] for the CS-minded)

Intro to Bioinformatics – Sequence Alignment21 Needleman-Wunsch: Step 2  Vertical/Horiz. move: Score + (simple) gap penalty  Diagonal move: Score + match/mismatch score  Take the MAX of the three possibilities

Intro to Bioinformatics – Sequence Alignment22 Needleman-Wunsch: Step 2 (cont’d)  Fill out the rest of the table likewise…

Intro to Bioinformatics – Sequence Alignment23 Needleman-Wunsch: Step 2 (cont’d)  Fill out the rest of the table likewise…  The optimal alignment score is calculated in the lower-right corner

Intro to Bioinformatics – Sequence Alignment24 But what is the optimal alignment  To reconstruct the optimal alignment, we must determine of where the MAX at each step came from…

Intro to Bioinformatics – Sequence Alignment25 A path corresponds to an alignment  = GAP in top sequence  = GAP in left sequence  = ALIGN both positions  One path from the previous table:  Corresponding alignment (start at the end): AC--TCG ACAGTAG Score = +2

Intro to Bioinformatics – Sequence Alignment26 Algorithm Analysis  Brute force approach If the length of both sequences is n, number of possibility = C(2n, n) = (2n)!/(n!) 2  2 2n / (  n) 1/2, using Sterling’s approximation of n! = (2  n) 1/2 e -n n n. O(4 n )  Dynamic programming O(mn), where the two sequence sizes are m and n, respectively O(n 2 ), if m is in the order of n

Intro to Bioinformatics – Sequence Alignment27 Practice Problem  Find an optimal alignment for these two sequences: GCGGTT GCGT  Match: +1  Mismatch: 0  Gap: –1

Intro to Bioinformatics – Sequence Alignment28 Practice Problem  Find an optimal alignment for these two sequences: GCGGTT GCGT GCGGTT GCG-T- Score = +2

Intro to Bioinformatics – Sequence Alignment29 Semi-global alignment  Suppose we are aligning: GCG GGCG  Which do you prefer? G-CG-GCG GGCGGGCG  Semi-global alignment allows gaps at the ends for free.

Intro to Bioinformatics – Sequence Alignment30 Semi-global alignment  Semi-global alignment allows gaps at the ends for free.  Initialize first row and column to all 0’s  Allow free horizontal/vertical moves in last row and column

Intro to Bioinformatics – Sequence Alignment31 Local alignment  Global alignments – score the entire alignment  Semi-global alignments – allow unscored gaps at the beginning or end of either sequence  Local alignment – find the best matching subsequence  CGATG AAATGGA  This is achieved by allowing a 4 th alternative at each position in the table: zero.

Intro to Bioinformatics – Sequence Alignment32 Local Sequence Alignment  Why local sequence alignment? Subsequence comparison between a DNA sequence and a genome Protein function domains Exons matching  Smith-Waterman algorithm D i,j = max{ D i-1,j + d(A i, –), D i,j-1 + d(–,B j ), D i-1,j-1 + d(A i,B j ), 0 } Initialization: D 1,j = , D i,1 = 

Intro to Bioinformatics – Sequence Alignment33 Local alignment  Score: Match = 1, Mismatch = -1, Gap = -1 CGATG AAATGGA

Intro to Bioinformatics – Sequence Alignment34 Local alignment  Another example

Intro to Bioinformatics – Sequence Alignment35 More Example  Align ATGGCCTC ACGGCTC Mismatch  = -3 Gap  = -4 --ACGGCTC A T G G C C T C Global Alignment: ATGGCCTC ACGGC-TC

Intro to Bioinformatics – Sequence Alignment36 More Example Local Alignment: ATGGCCTC ACGG CTC or ATGGCCTC ACGGC TC --ACGGCTC A T G G C C T C

Intro to Bioinformatics – Sequence Alignment37 Scoring Matrices for DNA Sequences  Transition: A  G C  T  Transversion: a purine (A or G) is replaced by a pyrimadine (C or T) or vice versa

Intro to Bioinformatics – Sequence Alignment38 Scoring Matrices for Protein Sequence  PAM (Percent Accepted Mutations) 250

Intro to Bioinformatics – Sequence Alignment39 Scoring Matrices for Protein Sequence  BLOSUM (BLOcks SUbstitution Matrix) 62

Intro to Bioinformatics – Sequence Alignment40 Using Protein Scoring Matrices  Divergence BLOSUM 80 BLOSUM 62 BLOSUM 45 PAM 1 PAM 120 PAM 250 Closely related Distantly related Less divergent More divergent Less sensitive More sensitive  Looking for Short similar sequences → use less sensitive matrix Long dissimilar sequences → use more sensitive matrix Unknown → use range of matrices  Comparison PAM – designed to track evolutionary origin of proteins BLOSUM – designed to find conserved regions of proteins