Fall 2014 HORT6033 Molecular plant breeding Instructor: Ainong Shi

Molecular Plant Breeding Fall 2014 HORT6033 Molecular Plant Breeding Lecture 1 (08/25/2014) Class Overview (5 min) Class Estimation Questions and Answers (15 min) SSR Marker and Tools (25 min) Homework (3 min) Questions (2 min)

Molecular Plant Breeding Fall 2014 HORT6033 Molecular Plant Breeding Instructor: Dr. Ainong Shi Phone: 479-575-2670 (o), 479-879-0159 (c) Email: ashi@uark.edu Office: PTSC 321 Office Hours: Please email to Ainong Shi at ashi@uark.edu to set up an appointment. But feel free to call or stop by.   Class Hours: MWF 9:40 – 10:30 am, August 25 – December 19, 2014 Classroom: UAF campus AGRI 0301A Lab Location: PTSC 322, open: 7 days a week Lab Assistant: Dr. Jianbing Ma (jxm044@uark.edu) Guest Instructor: Dr. John R. Clark, Dr. Pengyin Chen, Dr. Richard Esten Mason, Dr. Andy Pereira, Dr. Subodh Srivastava, and Dr. Weiguo Lu ………..

Student Info Register Name Major Email Marlovi Andrea Acuna Galindo CSES macunaga@uark.edu Abeer Muhammedali Jasim Al-Nasrawi CEMB amalnasr@email.uark.edu FNU Anuj Kumar axk018@email.uark.edu Jessica L Chitwood HORT jlchitwo@email.uark.edu Marcos Paulo Da Silva mpdasilv@email.uark.edu Mirta Beatriz Dalzotto mbdalzot@uark.edu Terrence James Frett PLSC tjfrett@email.uark.edu Clinton Philip Greub cpgreub@email.uark.edu Ashley Elizabeth Humphreys ENTO aemeyer@email.uark.edu Avjinder Singh Kaler askaler@email.uark.edu Mariola Klepadlo klepadlo@uark.edu Laura Melissa Lara Santisteban lmlarasa@uark.edu Jennifer Anne Lewter jlewter@uark.edu Cindy Massiel Lopez Ramirez cmlopezr@uark.edu Dennis Nicuh Bulusan Lozada dblozada@email.uark.edu Reiofeli Algodon Salas rasalas@email.uark.edu Shilpa Singh shilpa@email.uark.edu Vijay Singh vijay@email.uark.edu Brant Michael Smith PLPA bms010@email.uark.edu Janithri S. Wickramanayake jswickra@uark.edu Name Email Jianbing Ma jxm044@uark.edu Weiguo Lu 123bean@163.com Haizheng Xiong 390696518@qq.com Jun Qin hbnkydd@163.com Long Yan Dragonyan1979@163.com Maria Nelly Arguello Blanco mnarguellob@gmail.com Liliana Florez-Palacios sandrafp@email.uark.edu Register

Molecular Plant Breeding Fall 2014 HORT6033 Molecular Plant Breeding Lecture Lab Project Tools, Homework, Reading, and Research

Syllabus of Molecular Plant Breeding Fall 2014 HORT6033 Syllabus of Molecular Plant Breeding Course Description Course Objective and Outcome Grading Class Schedule Software and Tools Download and Installation Quiz and Examination (30%) Assignment (homework, computer tools, and reading) (30% + 5% bonus) Lab, Project, Report, Presentation, and Article Reading (30% + 10% bonus) Reading Materials Download Syllabus at http://comp.uark.edu/~ashi/MB/HORT6033_syllabus.pdf Course Web: http://comp.uark.edu/~ashi/MB

Molecular Plant Breeding Fall 2014 HORT6033 Molecular Plant Breeding Lecture 1 (08/25/2014) II. Class Estimation Questions and Answers 1. Quiz This is just an estimation to test which level each student has before the class, in order to divide students into groups. Download the questions at http://comp.uark.edu/~ashi/MB/HORT6033_Estimation_question.pdf 2. Quiz discussion http://comp.uark.edu/~ashi/MB/goodday/HORT6033_estimation_question_answer_08252014.pdf

III. SSR Marker and Tools SSR is repeating sequences of 2-5 (most of them) base pairs of DNA such as (AT)n, (CTC)n, (GAGT)n, (CTCGA)n SSR is called Microsatellites SSR usually is co-dominant SSR can be used: Fingerprinting Genetic diversity Genetic mapping Association mapping Marker-assisted selection Genome-wide selection etc. Left Figure: Allele #1: (CA)11 [SSR motif (CA) repeat 11 times] Allele #2: (CA)13 Allele #3: (CA)16 After PCR, the DNA sample with Allele #1, #2, #3 showing different size DNA fragment and the different combination of allele #1, #2, and #3 With different pattern with co-dominant. (image from http://www.cdfd.org.in/)

Example for SSR (AT)

1. SSRLocator SSR discovery for large DNA sequences, and also for primer design and PCR simulation (Maia et al. 2008. Int J Plant Genomics. 2008:412696)[PDF] Tools: from Plant Genomics and Breeding Center - Federal University of Pelotas – Brazil ( ufpel.edu.br ). Example: cowpea_EST_1_0693.fasta (linked) http://www2.ufpel.edu.br/faem/fitotecnia/fitomelhoramento/faleconosco.html

1. SSRLocator - running Install SSRLocator in C: as showing C:\SSRLocatorI Copy your data file with fasta format (.fasta) into the SSRLocatorI folder such as “cowpea_EST_1_0693.fasta”. Open SSRLocatorI.exe Format file to SSRLocator Standart in the “Create File” button. Save a new file called “cowpea_EST_1_0693format.fasta” And more …….

1. SSRLocator - Output The SSR motif (AT) creates various repeats from 12 to 20 among the five cowpea samples (below Loci in the Table). Primer pairs are designed and expected PCR size are estimated ranged 211 to 381 bp. The polymorphism can be used as marker – SSR marker ! Contig Loci Start_SSR1 End_SSR1 FG938745_UCRVU09_UCR_707 (AT)20 239 278 FG908248_UCRVU08_CCNS5607_IT97K-461-4 (AT)13 204 229 FG875445_UCRVU07_CCNP10713_UCR_779 (AT)12 205 228 FG850994_UCRVU05_CCNN17188_IT84S-2049 (AT)19 200 237 FG815463_UCRVU04_CCNI2988_524B (AT)15 216 245 Contig Foward TM Reverse Product Size FG938745 AACAGCTTAGAGCGTGAAAG 55.1 TTTCGATGTGTGAGAAATGA 381 FG908248 CAGCTGTTAAACCACACAAA 54.9 213 FG875445 211 FG850994 224 FG815463 216

2. MEGA and BioEdit MEGA 6 and BioEdit can be used to view SSR motifs among DNA samples (above from MEGA 6 and the bottom from BioEdit)

3. BatchPrimer3 BatchPrimer3 is the tool for primer design including Primers for SSRs. It can be used for SSR discovery as well. Tool website: http://batchprimer3.bioinformatics.ucdavis.edu/ Web tool: http://batchprimer3.bioinformatics.ucdavis.edu/cgi-bin/batchprimer3/batchprimer3.cgi An example cowpea_EST_1_0693.fasta”.

Molecular Plant Breeding Fall 2014 HORT6033 Molecular Plant Breeding Lecture 1 (08/25/2014) IV. Homework Download cowpea ESTs from GenBank Download and Install software SSRLocator Read SSRlocator manual and SSR articles Download MEGA 6, BioEdit and manuals

Molecular Plant Breeding Fall 2014 HORT6033 Molecular Plant Breeding Lecture 1 (08/25/2014) V. Homework Download cowpea ESTs from GenBank

2. Download and Install software SSRLocator V. Homework 2. Download and Install software SSRLocator Download the tools from Plant Genomics and Breeding Center - Federal University of Pelotas – Brazil ( ufpel.edu.br ). The tools for Windows Seven 32 bits should still work for Windows 64. You should download FireBird (database for store SSR data) and SSRLocator. The In the web page, you can see the link for Install Instruction and User Guide. You should also download or view the instruction for FireBird and SSRLocator, and also for User Guide!

V. Homework 3. Read SSR locator manual and SSR articles Manual download! SSR article:

Thanks! Dear Students: Please read and download homework and quiz at http://comp.uark.edu/~ashi/MB/molecularBreeding_homework.html ! Thanks!