Biology Journal 9/16/2014 2.4 Homework Quiz! True or false: Amino acids are bonded together in long chains by what are known as peptide bonds. True or false: The sequence of amino acids for a protein is found on code of the DNA. How many different kinds of amino acids are used by ribosomes to make proteins? What is a proteome?

Topic 2: Molecular biology (21 hours) 2.4 Proteins: Proteins have a very wide range of functions in living organisms. Nature of science: Looking for patterns, trends and discrepancies—most but not all organisms assemble proteins from the same amino acids. Understandings: Amino acids are linked together by condensation to form polypeptides. There are 20 different amino acids in polypeptides synthesized on ribosomes. Amino acids can be linked together in any sequence giving a huge range of possible polypeptides. Most organisms use the same 20 amino acids in the same genetic code although there are some exceptions. Specific examples could be used for illustration. The amino acid sequence of polypeptides is coded for by genes. A protein may consist of a single polypeptide or more than one polypeptide linked. The amino acid sequence determines the 3-D conformation of a protein. Living organisms synthesize many different proteins with a wide range of functions. Every individual has a unique proteome. Applications and skills: Application: Rubisco, insulin, immunoglobulins, rhodopsin, collagen and spider silk as examples of the range of protein functions. Application: Denaturation of proteins by heat or by deviation of pH from the optimum. Egg white or albumin solutions can be used in denaturation experiments. Application: Proteomics and the production of proteins by cells cultured in fermenters offer many opportunities for the food, pharmaceutical and other industries. Skill: Drawing molecular diagrams to show the formation of a peptide bond. Aims: Obtaining samples of human blood for immunological, pharmaceutical and anthropological studies is an international endeavour with many ethical issues.

a. What kind of molecule is this? b. What are its parts called? Review! a. What kind of molecule is this? b. What are its parts called? It’s an amino acid! (this one is called asparagine) R group (in this case CH2CONH2) Amine (NH2) Carboxyl (COOH) Alpha carbon (the middle C where the R group is attached)

Protein and Amino Acids Proteins do everything! Protein makes skin stretchy, bones tough, gives your body parts their color, lets you digest different foods, makes up hormones, creates your immune system …

Proteins are 1 chain of amino acids (sometimes multiple), that fold up into specific shapes based on the chemical properties of the amino acids.

Generalized Amino Acid How many amino acids make up this polypeptide?

There are 20 kinds of amino acids used in the human body.

Ribosomes: part of the cell that makes proteins from an RNA copy of the DNA code. They join amino acids together with peptide bonds. What do ribosomes do?

Turns garbage into bacon There are infinite possibilities of proteins! They can be any length, and any combination of amino acids. Turns garbage into bacon Your welcome.

We can break down proteins we eat to get energy / amino acids.

Changes in temperature Changes in pH Proteins can irreversibly lose their specific shape through a process called denaturing. Causes: Changes in temperature Changes in pH Denaturing

A fever can kill you! Why?

Proteome: The set of all of the proteins an organism makes. DNA in 23 chromosomes Transcribed into mRNA Genome Translated into an amino acid sequence by ribosomes Proteome Folds into proteins Polypeptide Every individual has its own unique genome which leads to its own unique proteome

Proteins do everything! Such as… Motor Proteins: They move, allowing cells to change shape. Muscle cells are packed with these.

Proteins do everything! Such as… Transport Proteins: These are proteins stuck in the cell membrane that let specific substances in or out of your cells.

Proteins do everything! Such as… Receptor Proteins: These are proteins stuck in the cell membrane that are used for cells to communicate with eachother.

Proteins do everything! Such as… Your immune system tells the difference between “self” and “non-self” by these receptors.

The blood types are: A, B, AB and O Blood types are an example of receptor proteins . The blood types are: A, B, AB and O Doctors killed a lot of dogs before they figured this one out…

Why is meat high in protein?

Muscles are made of protein Muscles are made of protein. Meat is high in protein because meat is animal muscle.

DNA Helicase Simplified model There are many ways of representing proteins DNA Helicase Simplified model

DNA Helicase Space-filling model There are many ways of representing proteins DNA Helicase Space-filling model

Model showing -helixes and -sheets. There are many ways of representing proteins DNA Helicase Model showing -helixes and -sheets.

20 amino acids bonded together in different orders can form all proteins. What do proteins do? Everything! The function of the protein is defined by its shape.

20 amino acids bonded together in different orders can form all proteins. Fibrous Long, insoluble proteins Parallel polypeptide chains Cross-linked Spider Silk

20 amino acids bonded together in different orders can form all proteins. Globular Folded, compact polypeptide chains Almost spherical shapes Rubisco Rhodopsin Insulin Immunoglobulin

Denaturation A process that destroys the complex structure of a protein. Heat Strong acids Strong alkalis New structure = new function Denaturation of an egg protein

Translated into an amino acid sequence by ribosomes Proteomics DNA in 23 chromosomes Transcribed into mRNA Genome Translated into an amino acid sequence by ribosomes Proteome Folds into proteins Polypeptide Every individual has its own unique genome which leads to its own unique proteome

Catabolic Hydrolysis Reaction A chemical reaction is shown below. Name each reactant and product. What kind of reaction is this? Where should water be present in the reaction? How many molecules of water? Review! Catabolic Hydrolysis Reaction Monopeptide (amino acid) Monopeptide (amino acid) Dipeptide → + H2O Hydrolysis (water is split) It “fills in” each monomer

→ A chemical reaction is shown below. Name each reactant and product. What kind of reaction is this? Where should water be present in the reaction? How many molecules of water? →

Catabolic Hydrolysis Reaction A chemical reaction is shown below. Name each reactant and product. What kind of reaction is this? Where should water be present in the reaction? How many molecules of water? Catabolic Hydrolysis Reaction Monopeptide (amino acid) Monopeptide (amino acid) Dipeptide → + H2O Hydrolysis (water is split) It “fills in” each monomer

Transcription and Translation

DNA has the “recipe” to make proteins. A gene is a segment of DNA that has the instructions to make a particular protein. “Hmmm… how many teaspoons of cytosine was I supposed to add?”

The base pairs on DNA determine the amino acids, and thus the specific shape, that the protein will have.

Of course, you can always change it later… For example… we all have genes for hair color. The base pairs on this DNA determines what proteins are in our hair, and thus, what our hair looks like. Of course, you can always change it later…

What does it mean to be a translator? What does it mean to transcribe something?

What’s the difference between DNA and RNA? DNA Structure RNA Structure Deoxyribonucleic acid Double stranded Uses thymine (T) Sugar used is deoxyribose (C5H10O4) Ribonucleic acid Single stranded Uses uracil (U) Sugar used is ribose (C5H10O5)

DNA and RNA comparison

When does your body need to make different kinds of proteins?

Transcription and translation is done every time a cell makes a protein. So, almost every cell in your body is doing this all the time! Above: the structural protein collagen. This poor guy will be making lots of it soon to repair his body.

Nowadays we don’t really need them, we have copy machines… Ancient Egypt was well known for its scribes that made copies of documents. Nowadays we don’t really need them, we have copy machines…

Some people transcribe their homework all the time. Transcription is making a copy of the DNA onto mRNA (messenger RNA). The enzyme that makes it is called RNA polymerase. Some people transcribe their homework all the time.

RNA is a disposable copy. mRNA is a temporary, disposable copy of DNA. It’s sent from the nucleus to the ribosome. DNA is permanent. You don’t want to change or mess with it. RNA is a disposable copy.

If this was a chain of DNA, what would the mRNA strand be? C T G A C T T A G A T A G A C U G A A U C U A U

What does DNA have the “recipe” to make? DNA is the recipe to make protein!

Ribosomes make proteins! What do ribosomes do? Ribosomes make proteins!

What are proteins made out of What are proteins made out of? Why do they have the shape that they have? Proteins are made out of amino acids. The different chemical properties of the amino acids cause the chain to fold up in specific ways.

Translation: mRNA goes to the ribosome, and it is translated into an amino acid sequence. tRNA (transfer RNA) brings the correct amino acid for every 3 base pairs.

Ribosomes have 2 “subunits” or pieces. Large Subunit Small Subunit

The 3 bases on mRNA is called a codon. The 3 bases on tRNA is called an anti-codon. The 3 bases on mRNA is called a codon.

How many different kinds of amino acids are used in the human body?

Every 3 base pairs corresponds to a different amino acid.

What amino acids does this mRNA code for? AUG UUA GAC CUC UGA

A translator puts information from one language into another. Translation puts the genetic code (AGTC’s) into the code of amino acids.

What amino acids does this mRNA code for? GUA AAA CUU CUA UAG

What do we call this step? What do we call this step? The translator (ribosome and tRNA) The scribe (RNA polymerase) Protein DNA mRNA What do we call this step? What do we call this step? Transcription Translation

Convert the DNA to mRNA Then, Convert the mRNA to amino acids. GCC TAT TCA CTA CTG CGG AUA AGU GAU GAC Isoleucine Serine Aspartic Acid Aspartic Acid Argenine What do we call this step? Transcription What do we call this step? Translation

Making a Protein

Making a Protein

This is called the central dogma of biology This is called the central dogma of biology. (That just means that it is a really important idea)

At the start of every gene is a TATA box At the start of every gene is a TATA box. It tells the mRNA polymerase where to start copying. Actual gene being transcribed TATA box DNA strand: TCCACGACTATACCGACTACTCTACGGGAATATG GGCUGAUGAGAUGCCCUUAUAC mRNA strand: mRNA gets a 5’GTP and a poly-A tail to mark the beginning and end. This helps identify it and “protect” it. Poly-A tail 5’ GTP PPPG AAAAAAAAA

Happens in the cytoplasm / at the ribosomes Biology Journal 10/18/2013 Transcription Translation RNA polymerase Ribosome tRNA Replication mRNA Protein DNA helicase DNA polymerase DNA Happens in the nucleus Happens in the cytoplasm / at the ribosomes Label each molecule (the pictures). Label the process that makes each molecule (the purple arrows). List the name of the enzymes / molecules that carry out each process. Identify the location where each of these molecules / processes are.

This is called the central dogma of biology This is called the central dogma of biology. (That just means that it is a really important idea)