PCR based Requiring sequence knowledge Molecular markers PCR based Requiring sequence knowledge courtesy of Carol Ritland

PCR markers prior sequence knowledge Microsatellites (SSR/STR/ STMS) SSCP ISSR T-RFLP

Microsatellite (SSR/STR/STMS) Also known as Short Sequence Repeat/Simple Tandem Repeats/Sequence-Tagged Microsatellite Sites Repeats are 1 to 10 nucleotides bp long Mutation rate is higher than base rate (1X104 vs 1X108) Related to VNTR (minisatellites) PCR based Require extensive labour prior to finding useable markers Can be expensive to find these markers Co-dominant Litt, M. and Lutty, J. A. Am. J. Hum. Genet. 1989 44:397-401

Allelic Variation at a Microsatellite Locus GCCATGACACACACAGTAACGT Allele “A” Allele “B” GCCATGACACACACACACACACACAGTAACGT

Mechanisms of mutation (slipped-strand mispairing) Step 1 Step 2 Step 3 Step 4 ca ca ca ca gt gt gt gt gt gt gt ca ca ca ca ca ca

Development of SSR Construction of DNA library Restriction Enzyme digestion Ligation to plasmid Screening for various repeats (Southern blot) Sequencing positive clones Primers design to flank microsatellites Testing Primers for polymorphism (need segregating families preferably with known parents) Focal vs Non focal species

Step by Step…. Restriction Digestion Gel electrophoresis Alu I AGCT Hae III GGCC Rsa I GTAC Isolate fragments Vector for cloning Ligase 200 to 500 bp Cloning and screen for positive clones

Step by Step cont’d CA positive clone Screen for repeats Using CACACA(25) probe Screen for repeats CA or CAT or CATA 1X106 clones Primer design from clones that show repeats Sequence all positive clones usually 96 at a time

SSR primer design 50% contain repeats < 10 bp 20% contain repeats starting at one end of the sequence 20% to 30% contain repeats that may be usable Watch for complex repeats eg. Compound = GCGGCCATATAT(16)GCGATGATATAT(16)GCGAA Irregular = GCGGCCATATATCCATATAT(16)CCATATGCG Complex = GCGGCCATATATCCATAT(12)GCTGCT(10)GCG Ideally design primers 18 to 24 nucleotides Aim for PCR product sizes that are > 100bp to 400bp

Primer testing Require ideally >3 populations for testing Ideally 6 individuals randomly sample per population 20% yield zero or poor amplicons 24% yield multiple or uninterruptible bands 18% monomorphic bands 38% usable microsatellite marker Squirrell et al. 2003 Mol. Ecol. 12:1339-1348

SSR gel  = female parental type = male parental type = size ladder WRC paternity analysis A. Miscampbell

Issues with Microsatellites (SSR) Highly variable and somatically stable marker Specific primers designed for target species (18-25 nt) Highly reproducible and yet evolve quickly (mutation rate is higher than normal rates) A co-dominant marker with high heritability Excellent for paternity/pedigree analysis Could be difficult to use between species (focal vs non focal species) Null alleles (lacking one of the allelic band for some heterozyote individuals within a population) test with family; excessive homozygotes, under estimate of diversity Stutter bands (due to Taq incomplete amplification) Subjectiveness when scoring (be consistent)

Scoring microsatellites Require known ladder to run with samples Resolve 2 or more bases differences using polyacrylamide gel Use base size to score allelic differences Sample Locus A Locus A’ Locus B Locus B’ Cat A 202 204 353 355 Cat B 200 206 357 Cat C 351

Score SSR gel: Samples = 21 204 bp 200 bp 175 bp 145 bp 120 bp 1 2 3 4   175 bp    145 bp 120 bp   1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 A1 A2 B1 B2 C! C2 D1 D2

Allelic variation and statistical analyses Matala, A.P., Gray, A.K., Heifetz, J. and Gharrett, A.J. (2004) Envior. Biololy of Fishes 69:201-210 Population structure of Shortkaker Rockfish

Example of allelic variation in microsatellites Microsatellite variation and genetic relationship among Rajasthani sheep: Relevance for conservation R Arora and S Bhatia