DNA. RECALL … 4 classes of macromolecules –Carbohydrates –Lipids –Proteins –NUCLEIC ACIDS!!! –Subunit (Building Blocks): NUCLEOTIDES.

Slides:



Advertisements
Similar presentations
Nucleic Acid Structure and Function. Function of DNA (DeoxyriboNucleic Acid) Contains sections called “genes” that code for proteins. These genes are.
Advertisements

MACROMOLECULES important to living things! 1._____________ 2. _____________ 3. _____________ (Fats, oils, waxes, steroids) 4._____________ Carbohydrates.
Nucleic Acids.
The Structure of DNA DNA Has the Structure of a Winding Staircase
The Structure of DNA.
DNA stands for Deoxyribonucleic acid DNA Structure DNA consists of two molecules that are arranged into a ladder-like structure called a Double Helix.
Objective: Understand the function of DNA
DNA Structure/Function. RECALL … 4 classes of macromolecules –Carbohydrates –Lipids –Proteins –NUCLEIC ACIDS!!! –Subunit: NUCLEOTIDES.
DNA Structure/Function. RECALL … 4 classes of macromolecules –Carbohydrates –Lipids –Proteins –NUCLEIC ACIDS!!! –Subunit: NUCLEOTIDES.
2A. Distinguish between DNA and RNA.
DNA The Blueprint of Life.
DNA Chapter 12.1/12.2.
DNA (deoxyribonucleic acid) consists of three components.
D.N.A. DeoxyriboNucleic Acid
DNA.
Chap. 10 : Nucleic Acids & Protein Synthesis I. DNA – deoxyribonucleic acid - function – store and use information to direct activities of the cell and.
Regents Biology Nucleic Acids Information storage.
Section 11.1 DNA: The Molecule of Heredity. Within the structure of DNA, is the complete instructions for manufacturing all the proteins for an organism.
DNA Structure. Essential Questions for Today What is DNA? What is a gene? What is the basic structure of DNA? What is the function of DNA?
DNA Introduction. What is DNA? Genetic information of life Type of Nucleic Acid Double Stranded.
DNA Structure and replication.  DNA (deoxyribonucleic Acid) carries the genetic code. DNA Structure.
DNA – Show Me What You’re Made of!!
Warm Up Draw a DNA molecule made from the 4 different nucleotides. Label each of the following one time: Hydrogen Bond Deoxyribose Phosphate Adenine Thymine.
DNA Deoxyribonucleic acid. DNA structure DNA is a nucleic acid –composed of many nucleotides –A nucleotide is composed of a sugar (deoxyribose), a phosphate.
DNA
The Structure of DNA. DNA is a nucleic acid. There are two types of nucleic acids: __________ or deoxyribonucleic acid __________ or ribonucleic acid.
Molecular Genetics DNA = Deoxyribonucleic Acid. Chromosomes are tightly coiled and compacted DNA DNA is twisted and wrapped around organizing proteins.
DNA Structure DNA: deoxyribose nucleic acid
Nucleic Acids Objective:
DNA The Blueprint of Life.
Higher Human Biology Sub topic 2a
2A. Distinguish between DNA and RNA.
Watson and Crick Using information from many researchers of their time, they assembled the first complete model of DNA as a double helix in 1953 Double.
2A. Distinguish between DNA and RNA.
MACROMOLECULES NUCLEIC ACIDS
DNA: The Molecule of Life
Nucleic Acids The stuff your genes are made of
DNA Structure and Replication
Nucleic Acids.
Deoxyribonucleic Acid
How does genetic information become traits we can observe?
DNA Deoxyribonucleic Acid
GENETICS Structure of DNA Wednesday, April 4th, 2018.
DNA & Genes 6A (RS) DNA: Identify components of DNA, and describe how information for specifying the traits of an organism is carried in the DNA.
What is the structure and function of DNA?
DNA (Deoxyribonucleic Acid)
What is DNA and how does it code for different traits?
Unit 6 Notes: DNA Structure
Unit 4 Notes: DNA Structure
Activity #42: DNA STRUCTURE
DNA Structure and Function
DNA!!.
RECALL… In our first unit (Biochemistry), we learned that there were 4 major organic compounds. Carbohydrates Lipids Proteins Nucleic Acids Nucleic Acids.
What is the structure and function of DNA?
DNA & RNA Notes Unit 3.
I. DNA.
Draw a DNA molecule made from the 4 different nucleotides
UNIT: DNA and RNA How does DNA store and transmit genetic information?
Nucleic Acids A macromolecule that carries our genetic material (DNA)
DNA Vocabulary.
DNA Structure.
Title: Nucleic Acids
Copyright Pearson Prentice Hall
Nucleic Acids.
Draw a DNA molecule made from the 4 different nucleotides
12 – 1 DNA.
Deoxyribonucleic Acid
Modern Genetics.
DNA Deoxyribonucleic Acid
Presentation transcript:

DNA

RECALL … 4 classes of macromolecules –Carbohydrates –Lipids –Proteins –NUCLEIC ACIDS!!! –Subunit (Building Blocks): NUCLEOTIDES

DNA – deoxyriboNUCLEIC ACID (de – without, oxy – oxygen, ribo – ribose sugar) Store and pass genetic information Building Block of DNA: nucleotides

DNA Very longVery long thin molecule made up of linked nucleotides Double stranded helix –Twisted ladder Determines traits of EVERY LIVING ORGANISM

Nucleotide Structure 3 parts –Sugar (deoxyribose or ribose) –Phosphate (P with oxygens attached) –Nitrogen base Adenine Thymine Guanine Cytosine

Nitrogen Base Pairing Adenine Thymine Guanine Cytosine All Tigers Can Growl

Nitrogen Base Pairing Adenine Thymine Guanine Cytosine = Hydrogen Bond

Nitrogen Base Pairing Adenine Thymine CytosineGuanine ThymineAdenine CytosineGuanine AdenineThymine Guanine Cytosine = Hydrogen Bond

Nitrogen Base Pairing Adenine Thymine CytosineGuanine ThymineAdenine CytosineGuanine AdenineThymine Guanine Cytosine

What is the COMPLEMENTARY DNA STRAND? EXAMPLE 1 ATTGACCATTGATAGCCGAATA TAACTGGTAACTATCGGCTTAT EXAMPLE 2 TCTTCGGAACATTAGTCGAGGC AGAAGCCTTGTAATCAGCTCCG

CHROMATID DNA ladder DNA double helix Chromatin Coiled up Chromatin 2 Chromatids

CHROMOSOME Chromatin 2 Chromatids 2 Chromatids = 1 Chromosome

Centromere Holds sister chromatids together in a chromosome

Chargraff’s Rule There will be the same number of bases as its complementary base in a DNA molecule. –EX: If there are 80 Adenines then there will be 80 Thymines. – If there is 20% A’s, then how many G’s will there be in a DNA molecule? 30% G’s Why? –Because if there are 20% A’s, then there must be 20% T’s = 40%. –100% - 40%= 60% left for C’s and G’s. –So, 30% for C’s and 30% for G’s.