High Throughput Sequencing: Microscope in the Big Data Era TexPoint fonts used in EMF: AAAAAAAAAAAAAAAA David Tse EASIT Chinese University of Hong Kong.

Slides:



Advertisements
Similar presentations
Reconstruction of DNA sequencing by hybridization Ji-Hong Zhang, Ling-Yun Wu and Xiang-Sun Zhang Institute of Applied Mathematics,
Advertisements

Mining Compressed Frequent- Pattern Sets Dong Xin, Jiawei Han, Xifeng Yan, Hong Cheng Department of Computer Science University of Illinois at Urbana-Champaign.
Lecture 24 Coping with NPC and Unsolvable problems. When a problem is unsolvable, that's generally very bad news: it means there is no general algorithm.
Reference mapping and variant detection Peter Tsai Bioinformatics Institute, University of Auckland.
Amplicon-Based Quasipecies Assembly Using Next Generation Sequencing Nick Mancuso Bassam Tork Computer Science Department Georgia State University.
Pamela Ferretti Laboratory of Computational Metagenomics Centre for Integrative Biology University of Trento Italy Microbial Genome Assembly 1.
June 3, 2015Windows Scheduling Problems for Broadcast System 1 Amotz Bar-Noy, and Richard E. Ladner Presented by Qiaosheng Shi.
Bioinformatics for Whole-Genome Shotgun Sequencing of Microbial Communities By Kevin Chen, Lior Pachter PLoS Computational Biology, 2005 David Kelley.
Alignment Problem (Optimal) pairwise alignment consists of considering all possible alignments of two sequences and choosing the optimal one. Sub-optimal.
Approximation Algorithms: Combinatorial Approaches Lecture 13: March 2.
How many transcripts does it take to reconstruct the splice graph? Introduction Alternative splicing is the process by which a single gene may be used.
Implicit Hitting Set Problems Richard M. Karp Harvard University August 29, 2011.
Class 02: Whole genome sequencing. The seminal papers ``Is Whole Genome Sequencing Feasible?'' ``Whole-Genome DNA.
1 Nicholas Mancuso Department of Computer Science Georgia State University Joint work with Bassam Tork, GSU Pavel Skums, CDC Ion M ӑ ndoiu, UConn Alex.
Implementation of Planted Motif Search Algorithms PMS1 and PMS2 Clifford Locke BioGrid REU, Summer 2008 Department of Computer Science and Engineering.
High Throughput Sequencing: Microscope in the Big Data Era
RNA-Seq Assembly: Fundamental Limits, Algorithms and Software TexPoint fonts used in EMF: AAAAAAAAAAAAAAAA David Tse Stanford University Symposium on Turbo.
Hardness Results for Problems P: Class of “easy to solve” problems Absolute hardness results Relative hardness results –Reduction technique.
Utilizing Fuzzy Logic for Gene Sequence Construction from Sub Sequences and Characteristic Genome Derivation and Assembly.
Hardness Results for Problems
Reconstruction of Haplotype Spectra from NGS Data Ion Mandoiu UTC Associate Professor in Engineering Innovation Department of Computer Science & Engineering.
The Science of Information: From Communication to DNA Sequencing TexPoint fonts used in EMF: AAAAAAAAAAAAAAAA David Tse U.C. Berkeley CUHK December 14,
Motif Discovery in Protein Sequences using Messy De Bruijn Graph Mehmet Dalkilic and Rupali Patwardhan.
De-novo Assembly Day 4.
Mon C222 lecture by Veli Mäkinen Thu C222 study group by VM  Mon C222 exercises by Anna Kuosmanen Algorithms in Molecular Biology, 5.
CS 394C March 19, 2012 Tandy Warnow.
Todd J. Treangen, Steven L. Salzberg
PE-Assembler: De novo assembler using short paired-end reads Pramila Nuwantha Ariyaratne.
Graphs and DNA sequencing CS 466 Saurabh Sinha. Three problems in graph theory.
1 Velvet: Algorithms for De Novo Short Assembly Using De Bruijn Graphs March 12, 2008 Daniel R. Zerbino and Ewan Birney Presenter: Seunghak Lee.
Sequence assembly using paired- end short tags Pramila Ariyaratne Genome Institute of Singapore SOC-FOS-SICS Joint Workshop on Computational Analysis of.
Graph Theory And Bioinformatics Jason Wengert. Outline Introduction to Graphs Eulerian Paths & Hamiltonian Cycles Interval Graph & Shape of Genes Sequencing.
JM - 1 Introduction to Bioinformatics: Lecture III Genome Assembly and String Matching Jarek Meller Jarek Meller Division of Biomedical.
Combinatorial Optimization Problems in Computational Biology Ion Mandoiu CSE Department.
Fragment assembly of DNA A typical approach to sequencing long DNA molecules is to sample and then sequence fragments from them.
RNA-Seq Assembly 转录组拼接 唐海宝 基因组与生物技术研究中心 2013 年 11 月 23 日.
Problems of Genome Assembly James Yorke and Aleksey Zimin University of Maryland, College Park 1.
More statistical stuff CS 394C Feb 6, Today Review of material from Jan 31 Calculating pattern probabilities Why maximum parsimony and UPGMA are.
billion-piece genome puzzle
Class 01 – Fragment assembly. DNA sequence data DNA sequence data is the motherlode of molecular biology. 10^10 base pairs. One human genome/year. It.
Implicit Hitting Set Problems Richard M. Karp Erick Moreno Centeno DIMACS 20 th Anniversary.
De novo discovery of mutated driver pathways in cancer Discussion leader: Matthew Bernstein Scribe: Kun-Chieh Wang Computational Network Biology BMI 826/Computer.
Theory and Practice of Software Testing
Computer Sciences Department1.  Property 1: each node can have up to two successor nodes (children)  The predecessor node of a node is called its.
Computer Science Background for Biologists CSC 487/687 Computing for Bioinformatics Fall 2005.
Whole Genome Sequencing (Lecture for CS498-CXZ Algorithms in Bioinformatics) Sept. 13, 2005 ChengXiang Zhai Department of Computer Science University of.
CS 173, Lecture B Introduction to Genome Assembly (using Eulerian Graphs) Tandy Warnow.
Sequencing technologies and Velvet assembly Lecturer : Du Shengyang September 29 , 2012.
COMPUTATIONAL GENOMICS GENOME ASSEMBLY
CS 395T: Computational phylogenetics January 18, 2006 Tandy Warnow.
Chapter 5 Sequence Assembly: Assembling the Human Genome.
Finding Motifs Vasileios Hatzivassiloglou University of Texas at Dallas.
ALLPATHS: De Novo Assembly of Whole-Genome Shotgun Microreads
CyVerse Workshop Transcriptome Assembly. Overview of work RNA-Seq without a reference genome Generate Sequence QC and Processing Transcriptome Assembly.
RNA Sequencing and transcriptome reconstruction Manfred G. Grabherr.
When the next-generation sequencing becomes the now- generation Lisa Zhang November 6th, 2012.
Information Theory of High-throughput Shotgun Sequencing David Tse Dept. of EECS U.C. Berkeley Tel Aviv University June 4, 2012 Research supported by NSF.
The Science of Information: From Communication to DNA Sequencing David Tse Dept. of EECS U.C. Berkeley UBC September 14, 2012 Research supported by NSF.
COMPUTATIONAL GENOMICS GENOME ASSEMBLY
Genome sequence assembly
Science of Information: Case Studies in DNA and RNA assembly
How to Solve NP-hard Problems in Linear Time
Alexander Zelikovsky Computer Science Department
Introduction to Genome Assembly
Jin Zhang, Jiayin Wang and Yufeng Wu
CS 598AGB Genome Assembly Tandy Warnow.
2nd (Next) Generation Sequencing
Chapter 11 Limitations of Algorithm Power
Next-generation DNA sequencing
Fragment Assembly 7/30/2019.
Presentation transcript:

High Throughput Sequencing: Microscope in the Big Data Era TexPoint fonts used in EMF: AAAAAAAAAAAAAAAA David Tse EASIT Chinese University of Hong Kong July 7, 2014 Research supported by NSF Center for Science of Information.

DNA sequencing …ACGTGACTGAGGACCGTG CGACTGAGACTGACTGGGT CTAGCTAGACTACGTTTTA TATATATATACGTCGTCGT ACTGATGACTAGATTACAG ACTGATTTAGATACCTGAC TGATTTTAAAAAAATATT…

High throughput sequencing revolution tech. driver for communications

Shotgun sequencing read

Technologies Sequence r Sanger 3730xl 454 GSIon Torrent SOLiDv4Illumina HiSeq 2000 Pac Bio Mechanis m Dideoxy chain terminatio n Pyrose quencin g Detection of hydrogen ion Ligation and two- base coding Reversi ble Nucleoti des Single molecule real time Read length bp 700 bp~400 bp bp 100 bp PE 1000~ bp Error Rate0.001%0.1%2%0.1%2%10-15% Output data (per run) 100 KB1 GB100 GB 1 TB10 GB

High throughput sequencing: Microscope in the big data era Genomic variations, 3-D structures, transcription, translation, protein interaction, etc. The quantities measured can be dynamic and vary spatially. Example: RNA expression is different in different tissues and at different times.

Computational problems for high throughput data measure data manage data utilize data Assembly (de Novo) Variant calling (reference-based assembly) Compression Privacy Genome wide association studies Phylogenetic tree reconstruction Pathogen detection Scope of this tutorial

Assembly: three points of view Software engineering Computational complexity theoretic Information theoretic

Assembly as a software engineering problem A single sequencing experiment can generate 100’s of millions of reads, 10’s to 100’s gigabytes of data. Primary concerns are to minimize time and memory requirements. No guarantee on optimality of assembly quality and in fact no optimality criterion at all.

Computational complexity view Formulate the assembly problem as a combinatorial optimization problem: –Shortest common superstring (Kececioglu-Myers 95) –Maximum likelihood (Medvedev-Brudno 09) –Hamiltonian path on overlap graph (Nagarajan-Pop 09) Typically NP-hard and even hard to approximate. Does not address the question of when the solution reconstructs the ground truth.

Information theoretic view Basic question: What is the quality and quantity of read data needed to reliably reconstruct?

Tutorial outline I. De Novo DNA assembly. I. De Novo RNA assembly

Themes Interplay between information and computational complexity. Role of empirical data in driving theory and algorithm development.

Part I: De Novo DNA Assembly TexPoint fonts used in EMF: AAAAAAAAAAAAAAAA

Shotgun sequencing model Basic model : uniformly sampled reads. Assembly problem: reconstruct the genome given the reads.

A Gigantic Jigsaw Puzzle

Challenges Long repeats Human Chr 22 repeat length histogram Illumina read error profile Read errors

Two-step approach First, we assume the reads are noiseless Derive fundamental limits and near-optimal assembly algorithms. Then, we add noise and see how things change.

Repeat statistics easier jigsaw puzzle harder jigsaw puzzle How exactly do the fundamental limits depend on repeat statistics?

Lower bound: coverage Introduced by Lander-Waterman in What is the number of reads needed to cover the entire DNA sequence with probability 1-²? N LW only provides a lower bound on the number of reads needed for reconstruction. N LW does not depend on the DNA repeat statistics!

reconstructable by greedy algorithm Simple model: I.I.D. DNA, G ! 1 (Motahari, Bresler & Tse 12) read length L 1 many repeats of length L no repeats of length L normalized # of reads coverage no coverage What about for finite real DNA?

i.i.d. fit data I.I.D. DNA vs real DNA Example: human chromosome 22 (build GRCh37, G = 35M) (Bresler, Bresler & Tse 12) Can we derive performance bounds on an individual sequence basis?

GREEDY DE B RUIJN SIMPLE B RIDGING MULTI B RIDGING Lander-Waterman coverage lower bound Individual sequence performance bounds repeat length Human Chr 19 Build 37 (Bresler, Bresler, Tse BMC Bioinformatics 13) L critical Given a genome s

Rhodobacter sphaeroides GAGE Benchmark Datasets Staphylococcus aureus G = 4,603,060 G = 2,903,081 G = 88,289,540 Human Chromosome14 MULTI B RIDGING lower bound MULTI B RIDGING lower bound MULTI B RIDGING lower bound

Lower bound: Interleaved repeats Necessary condition: all interleaved repeats are bridged. L m m n n In particular: L > longest interleaved repeat length (Ukkonen)

Lower bound: Triple repeats Necessary condition: all triple repeats are bridged In particular: L > longest triple repeat length (Ukkonen) L

length Lander-Waterman coverage lower bound Individual sequence performance bounds Human Chr 19 Build 37 (Bresler, Bresler, T. BMC Bioinformatics 13)

Greedy algorithm (TIGR Assembler, phrap, CAP3...) Input: the set of N reads of length L 1.Set the initial set of contigs as the reads 2.Find two contigs with largest overlap and merge them into a new contig 3.Repeat step 2 until only one contig remains

Greedy algorithm: first error at overlap A sufficient condition for reconstruction: repeat bridging read already merged contigs all repeats are bridged L

longest interleaved repeats at length 2248 lower bound longest repeat at Back to chromosome 19 GRCh37 Chr 19 (G = 55M) greedy algorithm non-interleaved repeats are resolvable!

Dense Read Model As the number of reads N increases, one can recover exactly the L-spectrum of the genome. If there is at least one non-repeating L-mer on the genome, this is equivalent information to having a read at every starting position on the genome. Key question: What is the minimum read length L for which the genome is uniquely reconstructible from its L-spectrum?

de Bruijn graph ATAGACCCTAGACGAT 1. Add a node for each (L-1)-mer on the genome. 2. Add k edges between two (L-1)-mers if their overlap has length L-2 and the corresponding L-mer appears k times in genome. (L = 5) TAGA AGCC AGCG GCCC GCGA CCCT CCTA CTAG ATAG CGAT AGAC

Eulerian path ATAGACCCTAGACGAT (L = 5) TAGA AGCC AGCG GCCC GCGA CCCT CCTA CTAG ATAG CGAT AGAC Theorem (Pevzner 95) : If L > max( l interleaved, l triple ), then the de Bruijn graph has a unique Eulerian path which is the original genome.

Resolving non-interleaved repeats non-interleaved repeat Unique Eulerian path. Condensed sequence graph

From dense reads to shotgun reads [Idury-Waterman 95] [Pevzner et al 01] Idea: mimic the dense read scenario by looking at K-mers of the length L reads Construct the K-mer graph and find an Eulerian path. Success if we have K-coverage of the genome and K > L critical

GREEDY DE B RUIJN length Lander-Waterman coverage lower bound De Bruijn algorithm: performance Human Chr 19 Build 37 Loss of info. from the reads!

Resolving bridged interleaved repeats interleaved repeat bridging read Bridging read resolves one repeat and the unique Eulerian path resolves the other.

GREEDY DE B RUIJN SIMPLE B RIDGING length Lander-Waterman coverage lower bound Simple bridging: performance Human Chr 19 Build 37

Resolving triple repeats triple repeat all copies bridged neighborhood of triple repeat all copies bridged resolve repeat locally

Triple Repeats: subtleties

Multibridging De-Brujin Theorem: (Bresler,Bresler, Tse 13) Original sequence is reconstructible if: 2. interleaved repeats are (single) bridged 3. coverage 1. triple repeats are all-bridged Necessary conditions for ANY algorithm: 1.triple repeats are (single) bridged 1.interleaved repeats are (single) bridged. 2.coverage.

GREEDY DE B RUIJN SIMPLE B RIDGING MULTI B RIDGING length Lander-Waterman coverage lower bound Multibridging: near optimality for Chr 19 Human Chr 19 Build 37

Rhodobacter sphaeroides GAGE Benchmark Datasets Staphylococcus aureus G = 4,603,060 G = 2,903,081 G = 88,289,540 Human Chromosome14 MULTI B RIDGING lower bound MULTI B RIDGING lower bound MULTI B RIDGING lower bound L critical L critical = length of the longest triple or interleaved repeat.

Gap Sulfolobus islandicus. G = 2,655,198 triple repeat lower bound interleaved repeat lower bound MULTIBRIDGING algorithm

Complexity: Computational vs Informational Complexity of MULTIBRIDGING –For a G length genome, O(G 2 ) Alternate formulations of Assembly –Shortest Common Superstring: NP-Hard –Greedy is O(G), but only a 4-approximation to SCS in the worst case –Maximum Likelihood: NP-Hard Key differences –We are concerned only with instances when reads are informationally sufficient to reconstruct the genome. –Individual sequence formulation lets us focus on issues arising only in real genomes.

Read Errors Error rate and nature depends on sequencing technology: Examples: Illumina: 0.1 – 2% substitution errors PacBio: 10 – 15% indel errors We will focus on a simple substitution noise model with noise parameter p. ACGTCCTATGCGTATGCGTAATGCCACATATTGCTATGCGTAATGCGT T A T A CTT A

Consistency Basic question: What is the impact of noise on L critical ? This question is equivalent to whether the L-spectrum is exactly recoverable as the number of noisy reads N -> 1. Theorem (C.C. Wang 13): Yes, for all p except p = ¾.

What about coverage depth? Theorem (Motahari, Ramchandran,Tse, Ma 13): Assume i.i.d. genome model. If read error rate p is less than a threshold, then Lander-Waterman coverage is sufficient for L > L critical For uniform distr. on {A,G,C,T}, threshold is 19%. A separation architecture is optimal: error correction assembly

Why? Coverage means most positions are covered by many reads. Multiple aligning overlapping noisy reads is possible if Assembly using noiseless reads is possible if noise averaging M

From theory to practice Two issues: 1)Multiple alignment is performed by testing joint typicality of M sequences, computationally too expensive. Solution: use the technique of finger printing. 2) Real genomes are not i.i.d. Solution: replace greedy by multibridging.

X-phased multibridging Prochlorococcus marinus Substitution errors of rate 1.5 % L critical Lam, Khalak, T. Recomb-Seq 14

More results Helicobacter pylori Methanococcus maripaludis Mycoplasma agalactiae Prochlorococcus marinus L critical

A more careful look Mycoplasma agalactiae L critical L critical-approx

Approximate repeat example: Yersinia pestis exact triple repeat, length 1662 approximate triple repeat length 5608

Acknowledgements DNA Assembly RNA Assembly Guy Bresler MIT Ma’ayan Bresler Berkeley Ka Kit Lam Berkeley Asif Khalak Pacific Biosciences Lior Pachter Berkeley Joseph Hui Berkeley Kayvon Mazooji Berkeley Abolfazl Motahari Sharif Soheil Mohajer U. of Minnesota Eren Sasoglu Berkeley Sreeram Kannan Berkeley