ACCESSING AND EXTRACTING CHIP-SEQ AND TF-GENE INTERACTIONS FROM PAZAR Jonathan Lim With Introduction by Wyeth Wasserman

Welcome If you encounter any technical difficulties during the webinar, type a report using the chat option Slide presentation ~25 min Compile Questions as they are submitted and answer them during the final Q&A/discussion period During the discussion session, we’ll allow audience speaking

Topics PAZAR Overview Data Retrieval Through Web Interface Data Files and Formats PAZAR Application Programming Interface (API) Q&A

4 Topics will increase in complexity as webinar progresses Data file formats will be presented in order of complexity, beginning with the simplest PAZAR API will be the most technical topic presented today and is geared toward those with programming knowledge 4 4

www.pazar.info Software framework for the construction and maintenance of regulatory sequence data annotation Allows multiple boutique databases to function independently within a larger system Public repository for regulatory data Each group manages its own deposit and distribution of data Envisioned as tool for capturing deep experimental annotation Species, cell line, treatment PAZAR is an open access and open development project

Browsing Data on PAZAR Link to project details

Project Information

Gene View Link to sequence details

Sequence Information

TF View

Data File Formats

Data Files available for Download

TF – Target Gene Format Provides listing of TFs and the genes that they putatively regulate In some cases, the gene is the most proximal to the TF binding site - especially true for ChIP-Seq regulatory sequences. PubMed ID and Analysis method provided as interaction evidence when available Files automatically exported for all public projects Updated weekly

TF – Target Gene File Example PAZAR TF ID TF Name PAZAR Gene ID Ensembl Gene Accession Chromosome Gene Start Coordinate Gene End Coordinate TF0001078 E2F4_HUMAN GS00121862 ENSG00000187634 1 860260 879955 Homo sapiens E2F4_Lee 21247883 PROTEIN BINDING ASSAY::CHROMATIN IMMUNOPRECIPITATION (CHIP) Species Project Name Evidence PMID Analysis Method

ChIP-Seq Peak Format For users who are only interested in ChIP-Seq peak data Provides peak information in a simple delimited format that is easy to work with Files will be exported for public projects containing ChIP-Seq data and updated weekly

ChIP-Seq Peak File Example chr1 915920 916350 916127 195.45 MAXHEIGHT ENSG00000187961 E2F4 Homo sapiens 21258399 Human Lymphoblastoid cells Peak start coordinate Peak max coordinate Chromosome Peak end coordinate Score Score type TF ID TF Name Species PMID Cell or Tissue

PAZAR GFF Format GFF format describes genes and other features associated with DNA, RNA and Protein sequences The PAZAR GFF format is intended to represent simple annotations One annotation record per line, one annotation for one sequence Not as comprehensive as XML files; represents a subset of total data, but may be easier for some people to work with Projects containing only artificial sequences (eg. jaspar_core) follow slightly different format. Refer to GFF format documentation for details. Files automatically exported for all public projects Updated weekly

PAZAR GFF File Example chr12 E2F4_Lee RS0293021 82752225 82752317 . + . sequence="CA…AT";db_seqinfo="ENSEMBL:60_37E";db_geneinfo="ENSEM BL:ENSG00000127720:C12ORF26 ";species="HOMO SAPIENS"; db_tfinfo="EnsEMBL_transcript:ENST00000394351:E2F4_HUMAN";analysis _name="ANALYSIS 1";analysis_comment="0";cell_type="HUMAN LYMPHOBLASTOID (GM06990) CELLS :HOMO SAPIENS";pmid="21258399";method="PROTEIN BINDING ASSAY::CHROMATIN IMMUNOPRECIPITATION (CHIP)";evidence="CURATED" Sequence start coordinate Sequence end coordinate Chromosome Project Name PAZAR Feature ID Strand Score Frame Mandatory Attributes Optional Attributes

PAZAR XML Format Extensible Markup Language (XML) is a markup language that defines a set of rules for encoding documents PAZAR XML schema defined for capturing data and relationships Comprehensive and flexible enough to capture many types of data Files automatically exported for all public projects Updated weekly

Sample PAZAR XML File <reg_seq pazar_id="rs_0022" quality="TESTED" sequence="CGGGCTCTCCGACCCACGGGTCACTTTTGACAGCTGGCCTGAGTCCTGCCTGGTGGAAACCCCTCCTGGGAGGCTGGAGCCAGCACCAGGGCCCACGTGTGCTT CACCTTGAAGCCTGAGGACACAGACTCTCCGGCAATCACATAGCCCATGTTGAGGACGCTGCCTTCAATGGAGCACGTGATCATGGACGCCACGCCAGTGCCCATGAGGGTGA GGGTGAGCGTGCCTCTCTTGGTGATGATGTCCAG" tfbs_name=""> …. <peak maxcoord="1857289"/> </reg_seq> <funct_tf funct_tf_name=“E2F4_HUMAN" pazar_id="fu_001"> <tf_unit pazar_id="tu_0001" tf_id="tf_001"/> </funct_tf> <interaction pazar_id="in_00063" quantitative="299.77" scale="MAXHEIGHT"/> Understanding of schema and parsing work required to extract ChIP-Seq data

PAZAR API Overview Application Programming Interface (API) facilitates programmatic retrieval of data contained in 'Published' or 'Open' projects as well as user's own restricted projects. Provides a mechanism for automating bulk data retrieval in a customized fashion Provides Methods to make it easier to work with data once it has been retrieved Object – oriented -> data types within the system can be mirrored as objects in code Uses the perl programming language Uses SOAP communication protocol for transferring data

SOAP Simple Object Access Protocol (SOAP) is a protocol for exchanging structured information between networked computers. It relies on Extensible Markup Language (XML) for its message format. Communication done using http as transport layer, can be used on any network that permits web browsing Client computer sends requests to server, which performs functions to retrieve data from database and return it to client Code to perform functions resides on the server, so client only needs to send requests in order to receive data Simple Object Access Protocol (SOAP) is a protocol for exchanging structured information between networked computers. It relies on Extensible Markup Language (XML) for its message format. - Communication done over http, can be used on any network that permits web browsing

Benefits of using SOAP Users do not have to worry about installing the API code on their computer Updates to newer API releases involve minimal effort Can be used across firewalls where only web browsing is permitted Transparent – users don't have to learn new syntax or change the way they code Language independent, but yet to be further developed and tested with programming languages other than perl in mind Data privacy can be managed by the PAZAR team since authentication is done on the server side

Data Privacy Access to data through API same as through website. PAZAR username and password must be supplied to retrieve data from personal restricted projects. Authentication is performed on PAZAR server Request Parameters Access To Restricted Data Access To Public Data Correct user/password and user is a member of specified project Results from specific restricted project being queried Results from all public projects Incorrect username / password combination or invalid project name or user not a member of specified project Results from all public projects only Project status is open or published Results from specific public project being queried and all other public projects (authentication not required)

PAZAR API Classes pazar class - handles authentication and contains general methods for retrieving data and creating instance objects of other classes - a PAZAR object must always be created first. It is supplied to all methods in other classes. pazar::project - handles project information pazar::dbsource - handles information source data pazar::gene - handles gene information pazar::reg_seq - handles regulatory sequence information pazar::tf - Transcription Factor meta information and general methods for retrieving TF-related information pazar::tf::tfcomplex - handles Transcription Factor complex information pazar::tf::subunit - handles Transcription Factor subunit information pazar::tf::target - handles Transcription Factor target (regulatory sequence, artificial sequence or binding site matrix) information pazar::transcript - handles transcript information pazar::tsr - handles transcription start region information

PAZAR API Documentation www.pazar.info/apidocs

API Setup 1. Install perl library SOAP::Lite v 0.60a by Paul Kulchenko . Later versions of SOAP::Lite maintained by different author and not compatible with the PAZAR API. Can be downloaded from link in the PAZAR API user guide at http://www.pazar.info/apidocs/userguide.html Also available for download from CPAN at http://search.cpan.org/~byrne/SOAP-Lite-0.60a SOAP::Lite installation should follow standard procedures 2. Include the following at the top of your script, before any code that makes use of the API use SOAP::Lite +autodispatch => uri => 'http://www.pazar.info/pazar', proxy => 'http://www.pazar.info/cgi-bin/API0.01/pazarserv.cgi'; Any code that follows will automatically make use of PAZAR API modules via SOAP; no additional modules need to be installed on the client side. API0.01 may be replaced by a newer release number when available (eg. API0.02), to use the newer API Older API releases will continue to be in service after newer releases have been made available

Sample Perl Code Using PAZAR API #!/usr/bin/perl use SOAP::Lite +autodispatch => uri => 'http://www.pazar.info/pazar', proxy => 'http://www.pazar.info/cgi-bin/API0.01/pazarserv.cgi'; # change yourusername@domain.ca and yourpass to values for your own PAZAR account my $pazar = new pazar(-pazar_user=>'yourusername@domain.ca', -pazar_pass=>'yourpass'); my $proj = pazar::project::get_by_name(‘Demo',$pazar); print $proj -> status ."\n"; print $proj -> id ."\n"; print $proj -> project_name ."\n"; print $proj -> description ."\n"; my $project_name = $proj -> project_name; my $project_num=$proj->id; my @funct_tfs = $pazar->get_all_complex_ids($project_num); print "num tf complexes: ".scalar(@funct_tfs)."\n"; Setup

Future PAZAR API Development API testing with other programming languages such as Java and Python Expansion of variety of classes and methods offered Further support for ChIP-Seq data handling Update and import of data

Recap Browsing through current data online Web interface Data Files Available for download TF- target Gene list ChIP-Seq peak files GFF XML (all data) Bulk retrieval of most current data in customized way through programmatic approach PAZAR API

Q&A Please take a moment to type PAZAR-related questions/comments into the Chat box. The questions will be answered shortly.