Sequencing the Euchromatic Region of Chromosome 5 of Tomato

University of Delhi South Campus Akhilesh K. Tyagi J. P. Khurana P. Khurana Arun Sharma National Research Centre for Plant Biotechnology Nagendra K. Singh T. Mohapatra T. R. Sharma K. Gaikwad National Institute for Plant Genome Research Debasis Chattopadhyay Sabhyata Bhatia Indian Initiative on Tomato Genome Sequencing Centromeric Region Heterochromatic Region Euchromatic Region Telomeric Region UDSC & NIPGR NRCPB (0-60 cM) ( cM)

Confirmation of marker CT101 and its assigned seed BAC position on chromosome 5 Marker: CT101 Seed BAC: LE_HBa0191B01 Haplotype 1: -ACCCCTCAATATTTCGCTCCAA Haplotype 2: TGTATACTTGCGCCAGTTCAGGG L. esculentumL. pennelliiIL 5-1IL 5-2IL 5-3IL 5-4IL 5-5 Haplotype 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5, LE_HBa0191B01 Haplotype 2: L. pennellii, IL 5-1 (M82)

Confirmation of ten nucleation points (markers) on chromosome 5- specific IL lines cMMarkerAmplicon sizeHaplotypes Sequence 0CT bp M82, IL5-2, IL5-3, IL5-4, IL5-5 -ACCCCTCAATATTTCGCTCCAA TGTATACTTGCGCCAGTTCAGGG L. pennellii, IL5-1 7C2At1g bp M82, IL5-2, IL5-3, IL5-4, IL5-5 TAGATATGGT CTACCGA-AC L. pennellii, IL cLET-8-B23 (BAC-specific, non-marker region) 360 bp M82, IL5-2, IL5-3, IL5-4, IL5-5 GGCT-TTTAA--ATCTGCATTI/DGTTTCAGCT...GACT AAAATCAAGGTTGCGGATGCC...ACCAT-ATCI/DAGTA L. pennellii, IL5-1 11T bp M82, IL5-2, IL5-3, IL5-4, IL5-5 GTAG-GCTCGGCCACCTAT--GAGAGGT--GGTA ACGAA-GATAAGGCTGGGGTAACTGCACTCATCC L. pennellii, IL cLED-8-G31000 bp M82, IL5-3, IL5-4, IL5-5 CTCG...GTTTT-...TGA-TAAGTTTGAAAGI/DAAGTI/DI/DATAA TGAAI/DACAAATI/DCTGGGGCACACTGGGA...GGAA......GACT L. pennellii, IL5-1, IL5-2 37C2_At2g bp M82, IL5-1, IL5-3, IL5-4, IL5-5 TATCAA-G-CTTGACTGTT ATCGGCTAAACATGTCTAG L. pennellii, IL5-2 44C2_At3g bp M82, IL5-1, IL5-3, IL5-4, IL5-5 TGGTACCCAA GAACGA---T L. pennellii, IL C2_At4g24830 (BAC-specific, non-marker region) 600 bp M82, IL5-1, IL5-3, IL5-4, IL5-5 GCACGC--AATTGCAATCTTTG ATGTAAACCGCCATG---AACA L. pennellii, IL5-2 57T bp M82, IL5-1, IL5-3, IL5-4, IL5-5 CTAATCATCCA ACTTCTGCAGG L. pennellii, IL TG 96 (BAC-specific, non-marker region) 400 bp M82, IL5-1, IL5-3, IL5-4, IL5-5 TCCAT...C CTACCI/DG L. pennellii, IL5-2

Mapping of BAC clones on chromosome 5 using FISH BAC: LE_HBa0189E17 Marker: T0564 at 11 cM 119 cM Chromosome 5 0 cM 30 cM 60 cM 90 cM UDSC + NIPGR NRCPB BAC: LE_HBa0138J03 Marker: T1746 at 84 cM

Single streak of BAC clones from seed BAC library DNA extraction PCR with genetic marker for re-confirmation CHEF-analysis for size estimation Shotgun cloning and sequencing Searching for STCs (Sequence Tag Connector) SGN end- sequence database DNA fingerprinting (HindIII-digested) for BAC stock purity The path for genomic sequencing 1 TACGTG...TTAT 2 CGAACAI/DGACA IL-mapping for chromosome 5-specificity Polymorphism in PCR (digested) products presence of SNP/indels Assembly of sequence BAC annotation Overgo hybridization Selection of extension BAC Haplotype 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5, seed BAC 2: L. pennellii, IL 5-1

Sequencing status of BAC clones from short arm of chromosome 5 Euchromatic Region cMMarkerClones selectedStatus LE_HBa0191B01 LE_HBa0261K11 LE_HBa0042B19 LE_HBa0179E24 CT101 C2_At1g60200 cLET-8-B23 cLED-8-G3 Centromeric Region Heterochromatic Region Euchromatic Region Telomeric Region Long Arm Short Arm UDSC & NIPGR NRCPB Phase III Phase II SL_MboI0037H06Phase III SL_MboI0005B15Phase III SL_MboI0050C14 LE_HBa0189E17 Phase III T SL_MboI0095J08Phase II 0 SL_EcoRI0122H05Phase III Phase II Phase ISL_MboI0004P04 SL_EcoRI0101I15 Phase IIISL_EcoRI0086I08 LE_HBa0115F01Phase I SL_EcoRI0082N07 Phase II LE_HBa0135A02 Phase II T11810 T C2_At3g55120 TG T C2_At4g SL_MboI0079D24Phase I SL_EcoRI0028N03Phase III SL_EcoRI0037P02Phase II SL_MboI0115G01Phase I SL_MboI0079C22Phase I LE_HBa0057G22 Phase II LE_HBa0196G23Phase II LE_HBa0141A12 SL_EcoRI0019P03 Phase II Phase I LE_HBa0056N10Library LE_HBa0131D04Phase II LE_HBa0239D11Phase II LE_HBa0251J13Phase II LE_HBa0089M06Library LE_HBa0076P16Phase II LE_HBa0298C03 LE_HBa0138J03Phase II SL_MboI0093K24 SL_EcoRI0065K15 Library Phase II T1746 CT172 T T C2_At2g31970 LE_HBa0009H01Library SL_EcoRI0015E23Library SL_MboI0018L12Library LE_HBa0166A02Phase II LE_HBa0040C21Phase II LE_HBa0025A19 LE_HBa0309L13Phase IIC2_At2g01110 Library LE_HBa0201O22Library LE_HBa0169M21Phase IT1360 C2_At1g10500 T1584 CT130 TG185 CT LE_HBa0060G21Phase III LE_HBa0003C20Phase IIIBS LE_HBa0058L13Phase III LE_HBa0145P19Phase III LE_HBa0168M18Phase III SL_EcoRI0066O01Phase IITG441 CT242 T1592 TG432 CT167 LibrarySL_MboI0118J18

Annotation of tomato genome Number of BACsPredicted gene models Hits using SwissProt Hits using TAIRHits using RAP-db (53%)676 (77.5%)645 (74%) InterPro, BLASTP, GO Alignments with ESTs BAC sequence available in GenBank with keywords TOMGEN, ITAG Gene predictions by FGENESH,GeneMark,GlimmerHMM EuGene Unified gene models SwissProt V52 TAIR V6RAP- db Build4 first significant hit (<e-5) Repeat Masking and removal of contaminants Outputs uploaded in gff3 and txt file formats Batch001 (10 BACs)Batch002 (57 BACs) STRUCTURAL FUNCTIONAL

Highlights 3. Current status of BAC clones from chromosome 5, selected for sequencing * Thirteen BAC clones in phase III (8 submitted to NCBI) * Twenty BAC clones in phase II (10 submitted to NCBI) * Eight BAC clones in phase I * Ten BAC clones at various stages of library preparation and sequencing 2. Presently, 51 BAC clones, covering approximately ~4.6 Mb region, have been mapped and are in the sequencing pipeline 1. All BAC clones are being mapped on chromosome 5 by using chromosome 5-specific introgression lines 4. Of the ten BAC clones sent for FISH at Stephen Stack’s laboratory, Colorado, seven have been mapped on Chromosome 5 5. Novel CAPS markers are being used to map BACs that have been selected on the basis of ORFs at both ends 6. Functional annotation of proteins predicted by Eugene is being carried out as a participating member of ITAG

Designing primers from either/both BAC ends PCR amplification from S. pennellii and S. lycopersicum Comparison for SNPs Sequencing of S. pennellii PCR amplified product Designing CAPS marker Restriction digestion of PCR product from parents and 12 chr. IL pools PCR amplification from parents and chromosome-wise IL pools Validation by individual ILs from specific chromosome Procedure for the confirmation of BACs on tomato chromosomes using CAPS markers in Introgression Lines

100 bp ladderChromosome 8Chromosome 9Chromosome 10Chromosome 11Chromosome 12Chromosome 3Chromosome 4Chromosome 5Chromosome 6Chromosome 7Chromosome 1Chromosome 2S. pennelliiS. lycopersicum1 kb ladder 100 bp ladder Chromosome 8Chromosome 9Chromosome 10Chromosome 11Chromosome 12 Chromosome 3Chromosome 4Chromosome 5Chromosome 6 Chromosome 7 Chromosome 1Chromosome 2S. pennelliiS. lycopersicum1 kb ladder Digestion of PCR amplified products with Eco RV Confirmation of a BAC clone HBa0024M22 on tomato chromosome 5 using ILs

New BACs mapped on tomato chromosomes using CAPS markers

Contributors Prof. Akhilesh K. Tyagi Prof. J. P. Khurana Prof. P. Khurana Dr. A. K. Sharma Dr. Vikrant Gupta Dr. Saloni Mathur Dr. Shailendra Vyas Mr. Amol Solanke Mr. Rahul Kumar Ms. Rashmi Jain Mr. Rupesh K Jain Mr. Shaji Joseph V Dr. Nagendra K. Singh Dr. T. Mohapatra Dr. T. R. Sharma Dr. K. Gaikwad Dr. Kamlesh Batra Dr. Archana Singh Dr. Mahavir Yadav Dr. Rekha Dixit Dr. Pradeep K. Singh Mr. Vivek Dalal Ms. G. Chitra Mr. Awadhesh Pandit Mr. Sambit P. Sahoo Mr. Shashi B. Ojha Dr. Debasis Chattopadhyay Dr. Sabhyata Bhatia Dr. S. Dewan Ms. P. Chowdhury S. Shridhar UDSCNRCPBNIPGR IITGS

Criteria for BAC selection and confirmation 1.Selection of two candidate seed BACs on chromosome 5 specific marker 100 kb or more in size end sequence availability at SGN 4. BAC verification by direct sequencing using two marker/overlapping region-specific primers using vector-specific SP6 and T7 primers 2. Purity check of bacterial stock Hind III fingerprint of DNA isolated from six independent colonies 3. PCR amplification of genetic markers/overlapping region two marker/overlapping region-specific primer pairs 5. Size estimation/confirmation of BAC clone by CHEF analysis of Not I digested BAC DNA 6. Validation of BAC on chromosome 5 using Introgression Lines polymorphism in PCR products SNP detection of non-polymorphic bands

SP6 T7 SP6 T7 SP6 T7 HBa0179K09 (108 kb) MboI0032F07 (~140 kb) MboI0052O23 MboI0083J01 MboI0077G20 (92 kb) SP bp overlap (100%) bp overlap (100%) HBa0188L22 HBa0064M20 HBa0102G23 HBa0123J08 HBa0144B20 ~3.5 kb overlap ~1.4 kb overlap Primer pair 1 Primer pair 2 Primer pair 1 Primer pair 2 ~19 kb overlap ~15.5 kb overlap Chromosome 7 T1401 (COS) CT223 (RFLP) 95 cM Clones sequenced to Phase III level Clones sequenced to Phase II level Extension clones verified Red bars indicate the PCR positive nature of BAC clones using respective primer pairs Dotted line indicates the expected overlap Blue line shows the presence of mapped markers on the BAC clones BACs mapped on chromosome 7

BAC/MarkerAmplicon size HaplotypesSequence LE_HBa0179K09 SP6 ext. 750 bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09, SL_MboI0077G20 TACGTG...TTATGACT CGAACAI/DGACAATAG L. pennellii, IL7-2 T bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09 GA--A AGTTG L. pennellii, IL7-2 LE_HBa0179K09 T7 ext. 550 bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09, SL_MboI0077G20 ACC GTA L. pennellii, IL7-2 SL_MboI0032F0 7 SP6 ext. 700 bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09, SL_MboI0032f07 TCTC...TC...GG...AGTG- TGGAAG ATCAI/DCAI/DTAI/DGA-AT- TTTCA L. pennellii, IL7-2 Reallocation of marker T0876 and its associated BAC positions on chromosome 7

Designing primers from marker or BAC-specific sequences PCR amplification from genomic DNA of L. esculentum, L. pennellii and ILs of chromosome 5 Exo-SAP treatment to amplified PCR product Sequencing of PCR products with both Forward and Reverse primers Alignment of generated sequences Search of SNPs/InDels in ILs with respect to parents Confirmation of BAC position on chromosome 5 using Introgression Lines

Gene prediction & annotation of some sequenced BAC clones BACKnownPutatativeExpressedNo evidence Total LE_HBa0191B SL_MboI0005B SL_EcoRI0086I LE_HBa0261K LE_HBa0042B SL_MboI0037H LE_HBa0179K SL_MboI0077G LE_HBa0169M LE_HBa0334K LE_HBa0166A LE_HBa0040C LE_HBa0131D LE_HBa0006N LE_HBa0108A LE_HBa0239D LE_HBa0251J LE_HBa0245E Total

Annotation of some sequenced BAC clones

S. No.BAC cloneName of the geneOrganism 1LE_HBa0191B01UDP-glycosyl transferaseA. thaliana 2SL_MboI0005B15Pantothenate kinase family proteinL. esculentum 3SL_EcoRI0086I08Senescence-associated protein 5Hemerocallis 4SL_EcoRI0086I08Carbonic anhydraseS. lycopersicum 5LE_HBa0261K11Putrescine aminopropyltransferaseL. esculentum 6LE_HBa0042B19Beta fructosidase geneL. pennellii 7LE_HBa0042B19Nematode resistance-like protein (Gro1-6)S. tuberosum 8LE_HBa0042B19 Glyceraldehyde-3-phosphate dehydrogenase P. hybrida 9LE_HBa0179E24Tospovirus resistance protein C (Sw5-C)L. esculentum 10LE_HBa0179E24ACS6 geneL. esculentum 11LE_HBa0179E24Omega-3 fatty acid desaturase geneL. esculentum 12SL_MboI0037H06VFNT cherry pto locusL. esculentum 13SL_EcoRI0028N03cf-9 resistance gene clusterL. pimpinellifolium 14SL_EcoRI0028N03NBS-LRR resistance protein-likeL.. esculentum 15SL_EcoRI0028N03ACS 8 geneL.. esculentum 16LE_HBa0309L13Disease resistant gene (Mi-1 gene)L. esculentum 17LE_HBa0298C03Symbiosis receptor-like kinase (SYMRK)L. esculentum 18LE_HBa0298C03PHYB1 gene, complete CDSL. esculentum Important genes present on some BAC clones