Human Genome Sequence and Variability Gabor T. Marth, D.Sc. Department of Biology, Boston College Medical Genomics Course – Debrecen, Hungary, May 2006

Lecture overview 1. Genome sequencing strategies, sequencing informatics 2. Genome annotation, functional and structural features in the human genome 3. Genome variability, DNA nucleotide, structural, and epigenetic variations

1. The Human genome sequence

The nuclear genome (chromosomes)

The genome sequence the primary template on which to outline functional features of our genetic code (genes, regulatory elements, secondary structure, tertiary structure, etc.)

Completed genomes ~1 Mb ~100 Mb >100 Mb ~3,000 Mb

Main genome sequencing strategies Clone-based shotgun sequencing Whole-genome shotgun sequencing Human Genome ProjectCelera Genomics, Inc.

Hierarchical genome sequencing BAC library construction clone mapping shotgun subclone library construction sequencing sequence reconstruction (sequence assembly) Lander et al. Nature 2001

Clone mapping – “sequence ready” map

Hierarchical genome sequencing BAC library construction clone mapping shotgun subclone library construction sequencing/read processing sequence reconstruction (sequence assembly) Lander et al. Nature 2001

Shotgun subclone library construction BAC primary clone cloning vector sequencing vector subclone insert

Hierarchical genome sequencing BAC library construction clone mapping shotgun subclone library construction sequencing/read processing sequence reconstruction (sequence assembly) Lander et al. Nature 2001

Sequencing

Robotic automation Lander et al. Nature 2001

Base calling PHRED base = A Q = 40

Vector clipping

Hierarchical genome sequencing BAC library construction clone mapping shotgun subclone library construction sequencing/read processing sequence reconstruction (sequence assembly) Lander et al. Nature 2001

Sequence assembly PHRAP

Repetitive DNA may confuse assembly

Sequence completion (finishing) CONSED, AUTOFINISH gap region of low sequence coverage and/or quality

2. Human genome annotation

Genome annotation – Goals protein coding genesRNA genes repetitive elements GC content

The starting material AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT AGCTAGGCTCCGGATGCGACCAGCTTTGATAGATGAATATAGTGT GCGCGACTAGCTGTGTGTTGAATATATAGTGTGTCTCTCGATATGT AGTCTGGATCTAGTGTTGGTGTAGATGGAGATCGCGTGCTTGAG TCGTTCGTTTTTTTATGCTGATGATATAAATATATAGTGTTGGTG GGGGGTACTCTACTCTCTCTAGAGAGAGCCTCTCAAAAAAAAAGCT CGGGGATCGGGTTCGAAGAAGTGAGATGTACGCGCTAGXTAGTAT ATCTCTTTCTCTGTCGTGCTGCTTGAGATCGTTCGTTTTTTTATGCT GATGATATAAATATATAGTGTTGGTGGGGGGTACTCTACTCTCTCT AGAGAGAGCCTCTCAAAAAAAAAGCTCGGGGATCGGGTTCGAAGA AGTGAGATGTACGCGCTAGXTAGTATATCTCTTTCTCTGTCGTGCT

Coding genes – ab initio predictions ATGGCACCACCGATGTCTACGTGGTAGGGGACTATAAAAAAAAAAA Open Reading Frame = ORF Stop codon Start codon PolyA signal

Ab initio predictions Gene structure

Ab initio predictions …AGAATAGGGCGCGTACCTTCCAACGAAGACTGGG… splice donor site splice acceptor site

Ab initio predictions Genscan Grail Genie GeneFinder Glimmer etc… EST_genome Sim4 Spidey EXALIN

Homology based predictions ATGGCACCACCGATGTCTACGTGGTAGGGGACTATAAAAAAAAAAA ACGGAAGTCT known coding sequence from another organism GGACTATAAA expressed sequence genes predicted by homology Genomescan Twinscan etc…

Consolidation – gene prediction systems Otto Ensembl FgenesH Genscan Grail Genewise Sim4 dbEst

ncRNA genes prediction based on structure (e.g. tRNAs) for other novel ncRNAs, only homology-based predictions have been successful

Repeat annotations Repeat annotation are based on sequence similarity to known repetitive elements in a repeat sequence library

The landscape of the human genome

Gene annotations – # of coding genes Lander et al. Initial sequencing and analysis of the human genome, Nature, 2001

Gene annotations – gene length Lander et al. Initial sequencing and analysis of the human genome, Nature, 2001

Gene annotations – gene function Lander et al. Initial sequencing and analysis of the human genome, Nature, 2001

GC content and coding potential Lander et al. Initial sequencing and analysis of the human genome, Nature, 2001

ncRNAs Lander et al. Initial sequencing and analysis of the human genome, Nature, 2001

Segmental duplications Lander et al. Initial sequencing and analysis of the human genome, Nature, 2001

Repeat elements Lander et al. Initial sequencing and analysis of the human genome, Nature, 2001

Genes and repeats

Physical vs. genetic map (Mb/cM) 0.4 cM1.3 cM0.7 cM 0.4 Mb0.7 Mb0.3 Mb

3. Human genome variability

DNA sequence variations the reference Human genome sequence is 99.9% common to each human being sequence variations make our genetic makeup unique SNP the most abundant human variations are single-nucleotide polymorphisms (SNPs) – 10 million SNPs are currently known

DNA sequence variations insertion-deletion (INDEL) polymorphisms

Structural variations Speicher & Carter, NRG 2005

Structural variations Feuk et al. Nature Reviews Genetics 7, 85–97 (February 2006) | doi: /nrg1767

Detection of structural variants Feuk et al. Nature Reviews Genetics 7, 85–97 (February 2006) | doi: /nrg1767

Epigenetic changes: chromatin structure Sproul, NRG 2005

Epigenetic changes: DNA methylation Laird, NRC 2003