20/03/2008 Dept. of Pharmaceutics 1 APPLICATIONS OF BIOINFORMATICS IN DRUG DISCOVERY AND PROCESS RESEARCH Dr. Basavaraj K. Nanjwade M.Pharm., Ph.D Associate.

Slides:



Advertisements
Similar presentations
1 Real World Chemistry Virtual discovery for the real world Joe Mernagh 19 May 2005.
Advertisements

Unravelling the biochemical reaction kinetics from time-series data Santiago Schnell Indiana University School of Informatics and Biocomplexity Institute.
Drug design.  electronic databases  contain molecules which have been isolated or synthesized and tested by pharmaceutical companies for possible pharmaceutical.
Biological pathway and systems analysis An introduction.
CHAPTER 10 Basic Biopharmaceutics
Structural bioinformatics
S TRUCTURAL B IOINFORMATICS. A subset of Bioinformatics concerned with the of biological structures - proteins, DNA, RNA, ligands etc. It is the first.
Jeffery Loo NLM Associate Fellow ’03 – ’05 chemicalinformaticsforlibraries.
Nanotechnology in Drug Discovery- Development and Delivery
The Application of the Scientific Method: Preclinical Trials Copyright PEER.tamu.edu.
Introduction of Cancer Molecular Epidemiology Zuo-Feng Zhang, MD, PhD University of California Los Angeles.
OMICS Group Contact us at: OMICS Group International through its Open Access Initiative is committed to make genuine and.
Proteomics Understanding Proteins in the Postgenomic Era.
Bioinformatics Ayesha M. Khan Spring Phylogenetic software PHYLIP l 2.
Stages of drug development
Important Points in Drug Design based on Bioinformatics Tools History of Drug/Vaccine development –Plants or Natural Product Plant and Natural products.
Drug discovery and development
Protein Tertiary Structure Prediction
Combinatorial Chemistry and Library Design
Knowledgebase Creation & Systems Biology: A new prospect in discovery informatics S.Shriram, Siri Technologies (Cytogenomics), Bangalore S.Shriram, Siri.
Asia’s Largest Global Software & Services Company Genomes to Drugs: A Bioinformatics Perspective Sharmila Mande Bioinformatics Division Advanced Technology.
Development of Bioinformatics and its application on Biotechnology
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
Bioinformatics and it’s methods Prepared by: Petro Rogutskyi
Rational Drug Design Soma Mandal, Mee'nal Moudgil, Sanat K. Mandal.
A substance used in the diagnosis, treatment, or prevention of a disease or as a component of a medication A substance used in the diagnosis, treatment,
Chapter 13. The Impact of Genomics on Antimicrobial Drug Discovery and Toxicology CBBL - Young-sik Sohn-
Marine Drug Development and Delivery Prof. Dr. Basavaraj K. Nanjwade M. Pharm., Ph. D Department of Pharmaceutics KLE University College of Pharmacy BELGAUM ,
CS 790 – Bioinformatics Introduction and overview.
Daniel Brown. D9.1 Discuss the use of a compound library in drug design. Traditionally, a large collection of related compounds are synthesized individually.
Biomedical Research.
Introduction to Bioinformatics Spring 2002 Adapted from Irit Orr Course at WIS.
Use of Machine Learning in Chemoinformatics Irene Kouskoumvekaki Associate Professor December 12th, 2012 Biological Sequence Analysis course.
Function first: a powerful approach to post-genomic drug discovery Stephen F. Betz, Susan M. Baxter and Jacquelyn S. Fetrow GeneFormatics Presented by.
20/03/2008 Dept. of Pharmaceutics 1. Use of BIOINFORMATICS in Pharmaciutics 2  Presented By  Shafnan Nazar  Hamid Nasir 
Page 1 SCAI Dr. Marc Zimmermann Department of Bioinformatics Fraunhofer Institute for Algorithms and Scientific Computing (SCAI) Grid-enabled drug discovery.
BioPaths-Catalyze Drug Discovery, Development and Clinical Research
Rational Drug Design Dr Robert Sbaglia. Curriculum Vitae Bachelor of Science (Honours), University of Melbourne Bachelor of Science.
Bioinformatics MEDC601 Lecture by Brad Windle Ph# Office: Massey Cancer Center, Goodwin Labs Room 319 Web site for lecture:
Topic 4 - Database Design Unit 1 – Database Analysis and Design Advanced Higher Information Systems St Kentigern’s Academy.
“Journey of a Drug” From Test Tube TO Prescribing Physician.
Integration of Bioinformatics into Inquiry Based Learning by Kathleen Gabric.
© Paradigm Publishing, Inc.1 Chapter 2 Basic Concepts of Pharmacology.
Use of Machine Learning in Chemoinformatics
1 Biopharmaceutics Dr Mohammad Issa Saleh. 2 Biopharmaceutics Biopharmaceutics is the science that examines this interrelationship of the physicochemical.
Human Genomics Higher Human Biology. Learning Intentions Explain what is meant by human genomics State that bioinformatics can be used to identify DNA.
Chapter 1: The Nature of Analytical Chemistry
Basic Concepts of Pharmacology © Paradigm Publishing, Inc.
Shows tendency for mergers. These big companies may be shrinking – much research is now outsourced to low cost countries like Latvia, India, China and.
Docking and Virtual Screening Using the BMI cluster
신기술 접목에 의한 신약개발의 발전전망과 전략 LGCI 생명과학 기술원. Confidential LGCI Life Science R&D 새 시대 – Post Genomic Era Genome count ‘The genomes of various species including.
Molecular Modeling in Drug Discovery: an Overview
Physiochemical properties of drugs Some background to the Sirius T3.
Advantages of Good Drug-like Properties 손한표.
A substance used in the diagnosis, treatment, or prevention of a disease or as a component of a medication recognized or defined by the U.S. Food, Drug,
Designing Drugs Virtually P14D461P - Arni B. Hj. Morshidi P14D389P - Anisah Bt Ismail P14D397P - Syarifah Rohaya Bt Wan Idris P14D394P - Dayang Adelina.
Page 1 Computer-aided Drug Design —Profacgen. Page 2 The most fundamental goal in the drug design process is to determine whether a given compound will.
Drug Discovery &Development
Introduction of Biopharmaceutics & Pharmacokinetics
Chapter 1 Introduction to Biopharmaceutics & Pharmacokinetics
APPLICATIONS OF BIOINFORMATICS IN DRUG DISCOVERY
Important Points in Drug Design based on Bioinformatics Tools
Discovery and Development of Medicines
Molecular Docking Profacgen. The interactions between proteins and other molecules play important roles in various biological processes, including gene.
Biopharmaceutics Dr Mohammad Issa Saleh.
Virtual Screening.
Lixia Yao, James A. Evans, Andrey Rzhetsky  Trends in Biotechnology 
Insight into the Pharmaceutical Industry
Important Points in Drug Design based on Bioinformatics Tools
Introduction to Bioinformatic
Presentation transcript:

20/03/2008 Dept. of Pharmaceutics 1 APPLICATIONS OF BIOINFORMATICS IN DRUG DISCOVERY AND PROCESS RESEARCH Dr. Basavaraj K. Nanjwade M.Pharm., Ph.D Associate Professor Department of Pharmaceutics JN Medical College KLE University, Belgaum

20/03/2008Dept. of Pharmaceutics2 Bioinformatics Application of CS and informatics to biological and Drug Development science Application of CS and informatics to biological and Drug Development science Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. The ultimate goal of the field is to enable the discovery of new biological insights as well as to create a global perspective from which unifying principles in biology can be discerned The ultimate goal of the field is to enable the discovery of new biological insights as well as to create a global perspective from which unifying principles in biology can be discerned

20/03/2008Dept. of Pharmaceutics3 Bioinformatics Hub

20/03/2008Dept. of Pharmaceutics4 Bioinformatics Tools The processes of designing a new drug using bioinformatics tools have open a new area of research. However, computational techniques assist one in searching drug target and in designing drug in silco, but it takes long time and money. In order to design a new drug one need to follow the following path. The processes of designing a new drug using bioinformatics tools have open a new area of research. However, computational techniques assist one in searching drug target and in designing drug in silco, but it takes long time and money. In order to design a new drug one need to follow the following path. 1. Identify target disease 2. Study Interesting Compounds 3. Detection the Molecular Bases for Disease 4. Rational Drug Design Techniques 5. Refinement of Compounds 6. Quantitative Structure Activity Relationships (QSAR) 7. Solubility of Molecule 8. Drug Testing

20/03/2008Dept. of Pharmaceutics5 Bioinformatics Tools Identify Target Disease:- Identify Target Disease:- 1. One needs to know all about the disease and existing or traditional remedies. It is also important to look at very similar afflictions and their known treatments. 2. Target identification alone is not sufficient in order to achieve a successful treatment of a disease. A real drug needs to be developed.

20/03/2008Dept. of Pharmaceutics6 Bioinformatics Tools Identify Target Disease:- Identify Target Disease:- 3. This drug must influence the target protein in such a way that it does not interfere with normal metabolism. 4. Bioinformatics methods have been developed to virtually screen the target for compounds that bind and inhibit the protein.

20/03/2008Dept. of Pharmaceutics7 Bioinformatics Tools Study Interesting Compounds:- Study Interesting Compounds:- 1. One needs to identify and study the lead compounds that have some activity against a disease. compounds that have some activity against a disease. 2. These may be only marginally useful and may have severe side effects. may have severe side effects. 3. These compounds provide a starting point for refinement of the chemical structures. for refinement of the chemical structures.

20/03/2008Dept. of Pharmaceutics8 Bioinformatics Tools Detect the Molecular Bases for Disease:- Detect the Molecular Bases for Disease:- 1. If it is known that a drug must bind to a particular spot on a particular protein or nucleotide then a drug can be tailor made to bind at that site. 2. This is often modeled computationally using any of several different techniques.

20/03/2008Dept. of Pharmaceutics9 Bioinformatics Tools Detect the Molecular Bases for Disease:- Detect the Molecular Bases for Disease:- 3. Traditionally, the primary way of determining what compounds would be tested computationally was provided by the researchers' understanding of molecular interactions. 3. Traditionally, the primary way of determining what compounds would be tested computationally was provided by the researchers' understanding of molecular interactions. 4. A second method is the brute force testing of large numbers of compounds from a database of available structures. 4. A second method is the brute force testing of large numbers of compounds from a database of available structures.

20/03/2008Dept. of Pharmaceutics10 Bioinformatics Tools Rational drug design techniques:- Rational drug design techniques:- 1. These techniques attempt to reproduce the researchers' understanding of how to choose likely compounds built into a software package that is capable of modeling a very large number of compounds in an automated way. 1. These techniques attempt to reproduce the researchers' understanding of how to choose likely compounds built into a software package that is capable of modeling a very large number of compounds in an automated way. 2. Many different algorithms have been used for this type of testing, many of which were adapted from artificial intelligence applications. 2. Many different algorithms have been used for this type of testing, many of which were adapted from artificial intelligence applications.

20/03/2008Dept. of Pharmaceutics11 Bioinformatics Tools Rational drug design techniques:- Rational drug design techniques:- 3. The complexity of biological systems makes it very difficult to determine the structures of large biomolecules. 4. Ideally experimentally determined (x-ray or NMR) structure is desired, but biomolecules are very difficult to crystallize

20/03/2008Dept. of Pharmaceutics12 Bioinformatics Tools Refinement of compounds:- Refinement of compounds:- 1. Once you got a number of lead compounds have been found, computational and laboratory techniques have been very successful in refining the molecular structures to give a greater drug activity and fewer side effects.

20/03/2008Dept. of Pharmaceutics13 Bioinformatics Tools Refinement of compounds:- Refinement of compounds:- 2. Done both in the laboratory and computationally by examining the molecular structures to determine which aspects are responsible for both the drug activity and the side effects.

20/03/2008Dept. of Pharmaceutics14 Bioinformatics Tools Quantitative Structure Activity Relationships (QSAR):- Quantitative Structure Activity Relationships (QSAR):- 1. Computational technique should be used to detect the functional group in your compound in order to refine your drug. 2. QSAR consists of computing every possible number that can describe a molecule then doing an enormous curve fit to find out which aspects of the molecule correlate well with the drug activity or side effect severity. 3. This information can then be used to suggest new chemical modifications for synthesis and testing. chemical modifications for synthesis and testing.

20/03/2008Dept. of Pharmaceutics15 Bioinformatics Tools Solubility of Molecule:- Solubility of Molecule:- 1. One need to check whether the target molecule is water soluble or readily soluble in fatty tissue will affect what part of the body it becomes concentrated in. 2. The ability to get a drug to the correct part of the body is an important factor in its potency.

20/03/2008Dept. of Pharmaceutics16 Bioinformatics Tools Solubility of Molecule:- Solubility of Molecule:- 3. Ideally there is a continual exchange of information between the researchers doing QSAR studies, synthesis and testing. 4. These techniques are frequently used and often very successful since they do not rely on knowing the biological basis of the disease which can be very difficult to determine.

20/03/2008Dept. of Pharmaceutics17 Bioinformatics Tools Drug Testing:- Drug Testing:- 1. Once a drug has been shown to be effective by an initial assay technique, much more testing must be done before it can be given to human patients. 2. Animal testing is the primary type of testing at this stage. Eventually, the compounds, which are deemed suitable at this stage, are sent on to clinical trials. 3. In the clinical trials, additional side effects may be found and human dosages are determined.

20/03/2008Dept. of Pharmaceutics18 Structure Prediction flow chart

20/03/2008Dept. of Pharmaceutics19 Computer-Aided Drug Design (CADD) Computer-Aided Drug Design (CADD) is a specialized discipline that uses computational methods to simulate drug-receptor interactions. Computer-Aided Drug Design (CADD) is a specialized discipline that uses computational methods to simulate drug-receptor interactions. CADD methods are heavily dependent on bioinformatics tools, applications and databases. As such, there is considerable overlap in CADD research and bioinformatics. CADD methods are heavily dependent on bioinformatics tools, applications and databases. As such, there is considerable overlap in CADD research and bioinformatics.

20/03/2008Dept. of Pharmaceutics20 Bioinformatics Supports CADD Research Bioinformatics Supports CADD Research Virtual High-Throughput Screening (vHTS):- Virtual High-Throughput Screening (vHTS):- 1. Pharmaceutical companies are always searching for new leads to develop into drug compounds. 2. One search method is virtual high-throughput screening. In vHTS, protein targets are screened against databases of small-molecule compounds to see which molecules bind strongly to the target.

20/03/2008Dept. of Pharmaceutics21 Bioinformatics Supports CADD Research Virtual High-Throughput Screening (vHTS):- Virtual High-Throughput Screening (vHTS):- 3. If there is a “hit” with a particular compound, it can be extracted from the database for further testing. 4. With today’s computational resources, several million compounds can be screened in a few days on sufficiently large clustered computers. 5. Pursuing a handful of promising leads for further development can save researchers considerable time and expense. e.g.. ZINC is a good example of a vHTS compound library. e.g.. ZINC is a good example of a vHTS compound library.

20/03/2008Dept. of Pharmaceutics22 Bioinformatics Supports CADD Research Sequence Analysis:- Sequence Analysis:- 1. In CADD research, one often knows the genetic sequence of multiple organisms or the amino acid sequence of proteins from several species. 2. It is very useful to determine how similar or dissimilar the organisms are based on gene or protein sequences.

20/03/2008Dept. of Pharmaceutics23 Sequence Analysis:- Sequence Analysis:- 3. With this information one can infer the evolutionary relationships of the organisms, search for similar sequences in bioinformatic databases and find related species to those under investigation. 4. There are many bioinformatic sequence analysis tools that can be used to determine the level of sequence similarity. 4. There are many bioinformatic sequence analysis tools that can be used to determine the level of sequence similarity. Bioinformatics Supports CADD Research

20/03/2008Dept. of Pharmaceutics24 Bioinformatics Supports CADD Research Homology Modeling:- Homology Modeling:- 1. Another common challenge in CADD research is determining the 3-D structure of proteins. 2. Most drug targets are proteins, so it’s important to know their 3-D structure in detail. It’s estimated that the human body has 500,000 to 1 million proteins. 3. However, the 3-D structure is known for only a small fraction of these. Homology modeling is one method used to predict 3-D structure.

20/03/2008Dept. of Pharmaceutics25 Bioinformatics Supports CADD Research Homology Modeling:- Homology Modeling:- 4. In homology modeling, the amino acid sequence of a specific protein (target) is known, and the 3-D structures of proteins related to the target (templates) are known. 5. Bioinformatics software tools are then used to predict the 3-D structure of the target based on the known 3-D structures of the templates. 5. Bioinformatics software tools are then used to predict the 3-D structure of the target based on the known 3-D structures of the templates. 6. MODELLER is a well-known tool in homology modeling, and the SWISS-MODEL Repository is a database of protein structures created with homology modeling.

20/03/2008Dept. of Pharmaceutics26 Bioinformatics Supports CADD Research Similarity Searches:- Similarity Searches:- 1. A common activity in biopharmaceutical companies is the search for drug analogues. 2. Starting with a promising drug molecule, one can search for chemical compounds with similar structure or properties to a known compound. 3. There are a variety of methods used in these searches, including sequence similarity, 2D and 3D shape similarity, substructure similarity, electrostatic similarity and others. 4. A variety of are available for this work 4. A variety of bioinformatic tools and search engines are available for this work

20/03/2008Dept. of Pharmaceutics27 Bioinformatics Supports CADD Research Drug Lead Optimization:- Drug Lead Optimization:- 1. When a promising lead candidate has been found in a drug discovery program, the next step (a very long and expensive step!) is to optimize the structure and properties of the potential drug. 2. This usually involves a series of modifications to the primary structure (scaffold) and secondary structure (moieties) of the compound.

20/03/2008Dept. of Pharmaceutics28 Bioinformatics Supports CADD Research Drug Lead Optimization:- Drug Lead Optimization:- 3. This process can be enhanced using software tools that explore related compounds (bioisosteres) to the lead candidate. OpenEye’s WABE is one such tool. 4. Lead optimization tools such as WABE offer a rational approach to drug design that can reduce the time and expense of searching for related compounds.

20/03/2008Dept. of Pharmaceutics29 Bioinformatics Supports CADD Research Physicochemical Modeling:- Physicochemical Modeling:- 1. Drug-receptor interactions occur on atomic scales. 1. Drug-receptor interactions occur on atomic scales. 2. To form a deep understanding of how and why drug 2. To form a deep understanding of how and why drug compounds bind to protein targets, we must consider compounds bind to protein targets, we must consider the biochemical and biophysical properties of both the the biochemical and biophysical properties of both the drug itself and its target at an atomic level. drug itself and its target at an atomic level. 3. Swiss-PDB is an excellent tool for doing this. Swiss-PDB 3. Swiss-PDB is an excellent tool for doing this. Swiss-PDB can predict key physicochemical properties, such as can predict key physicochemical properties, such as hydrophobicity and polarity that have a profound hydrophobicity and polarity that have a profound influence on how drugs bind to proteins. influence on how drugs bind to proteins.

20/03/2008Dept. of Pharmaceutics30 Bioinformatics Supports CADD Research Drug Bioavailability and Bioactivity:- Drug Bioavailability and Bioactivity:- 1. Most drug candidates fail in Phase III clinical trials after many years of research and millions of dollars have been spent on them. And most fail because of toxicity or problems with metabolism. 2. The key characteristics for drugs are Absorption, Distribution, Metabolism, Excretion, Toxicity (ADMET) and efficacy—in other words bioavailability and bioactivity. 3. Although these properties are usually measured in the lab, they can also be predicted in advance with bioinformatics software. 3. Although these properties are usually measured in the lab, they can also be predicted in advance with bioinformatics software.

20/03/2008Dept. of Pharmaceutics31 Benefits of CADD Cost Savings:- Cost Savings:- 1. The Tufts Report suggests that the cost of drug discovery and development has reached $800 million for each drug successfully brought to market. 2. Many biopharmaceutical companies now use computational methods and bioinformatics tools to reduce this cost burden.

20/03/2008Dept. of Pharmaceutics32 Benefits of CADD Cost Savings:- Cost Savings:- 3. Virtual screening, lead optimization and predictions of bioavailability and bioactivity can help guide experimental research. 4. Only the most promising experimental lines of inquiry can be followed and experimental dead- ends can be avoided early based on the results of CADD simulations.

20/03/2008Dept. of Pharmaceutics33 Benefits of CADD Time-to-Market:- Time-to-Market:- 1. The predictive power of CADD can help drug research programs choose only the most promising drug candidates. 2. By focusing drug research on specific lead candidates and avoiding potential “dead-end” compounds, biopharmaceutical companies can get drugs to market more quickly. 2. By focusing drug research on specific lead candidates and avoiding potential “dead-end” compounds, biopharmaceutical companies can get drugs to market more quickly.

20/03/2008Dept. of Pharmaceutics34 Benefits of CADD Insight:- Insight:- 1. One of the non-quantifiable benefits of CADD and the use of bioinformatics tools is the deep insight that researchers acquire about drug- receptor interactions. 2. Molecular models of drug compounds can reveal intricate, atomic scale binding properties that are difficult to envision in any other way.

20/03/2008Dept. of Pharmaceutics35 Benefits of CADD Insight:- Insight:- 1. When we show researchers new molecular models of their putative drug compounds, their protein targets and how the two bind together, they often come up with new ideas on how to modify the drug compounds for improved fit. 2. This is an intangible benefit that can help design research programs.

20/03/2008Dept. of Pharmaceutics36 CADD CADD and bioinformatics together are a powerful combination in drug research and development. CADD and bioinformatics together are a powerful combination in drug research and development. An important challenge for us going forward is finding skilled, experienced people to manage all the bioinformatics tools available to us, which will be a topic for a future article. An important challenge for us going forward is finding skilled, experienced people to manage all the bioinformatics tools available to us, which will be a topic for a future article.

20/03/2008Dept. of Pharmaceutics37 Research Achievements Software developed Software developed Bioinformatics data base developed Bioinformatics data base developed Traditional medicine research tools developed Traditional medicine research tools developed

20/03/2008Dept. of Pharmaceutics38 Software developed 1. SVMProt: Protein function prediction software 2. INVDOCK: Drug target prediction software 3. MoViES: Molecular vibrations evaluation server

20/03/2008Dept. of Pharmaceutics39 Bioinformatics database developed 1. Therapeutic target database Drug adverse reaction target database Drug ADME associated protein database Kinetic data of biomolecular interactions database Computed ligand binding energy database

20/03/2008Dept. of Pharmaceutics40 Traditional medicine research tools developed 1. Traditional medicine information database 2. Herbal ingredient and content database 3. Natural product effect and consumption info system info system 4. Traditional medicine recipe prediction and validation system validation system 5. Herbal target identification system

20/03/2008Dept. of Pharmaceutics41 THANK YOU