Bioinformatics On Genomics Hsueh-Fen Yuki Juan April 28, 2003.

Slides:

Advertisements

Similar presentations

DNA sequence analysis Xu Cheng. DNA sequence analysis Retrieving DNA sequences from databases Computing nucleotide compositions Identifying restriction.

Advertisements

From Genome to Proteome Juang RH (2004) BCbasics Systems Biology, Integrated Biology.

NCBI BLAST, CDD, Mini-courses Katia Guimarães 2007/2.

© Wiley Publishing All Rights Reserved. How Most People Use Bioinformatics.

Bioinformatics Tutorial I BLAST and Sequence Alignment.

Bioinformatics Unit 1: Data Bases and Alignments Lecture 2: “Homology” Searches and Sequence Alignments.

BIOINFORMATICS Ency Lee.

Sequence Analysis MUPGRET June workshops. Today What can you do with the sequence? What can you do with the ESTs? The case of SNP and Indel.

Expect value Expect value (E-value) Expected number of hits, of equivalent or better score, found by random chance in a database of the size.

Bioinformatics on Proteomics Hsueh-Fen Juan April 24, 2003 NTNU.

The Cell, Central Dogma and Human Genome Project.

阮雪芬 Department of Life Aug 6, 2004

基因與蛋白質資料庫阮雪芬 Nov 20 & 27, 2002 NTU. Index Genome Sequence searching Cutting site for a specific sequence Restriction Mapper REBASE REBsite NEB cutter.

Review of Laboratory 3 Spectrophotometric determination of DNA quantity, purity Abs 260 nmAbs 280 nmAbs 320 nmAbs 260/Abs

© Wiley Publishing All Rights Reserved. Biological Sequences.

Arabidopsis Gene Project GK-12 April Workshop Karolyn Giang and Dr. Mulligan.

Making Sense of DNA and protein sequence analysis tools (course #2) Dave Baumler Genome Center of Wisconsin,

DOT PLOT Daniel Svozil. Software choice source: Bioinformatics for Dummies.

Wellcome Trust Workshop Working with Pathogen Genomes Module 3 Sequence and Protein Analysis (Using web-based tools)

Bioinformatics.

Basic Introduction of BLAST Jundi Wang School of Computing CSC691 09/08/2013.

Introduction to Bioinformatics CPSC 265. Interface of biology and computer science Analysis of proteins, genes and genomes using computer algorithms and.

NCBI Review Concepts Chuong Huynh. NCBI Pairwise Sequence Alignments Purpose: identification of sequences with significant similarity to (a)

Common Errors in Student Annotation Submissions contributions from Paul Lee, David Xiong, Thomas Quisenberry Annotating multiple genes at the same locus.

Module 3 Sequence and Protein Analysis (Using web-based tools) Working with Pathogen Genomes - Uruguay 2008.

CISC667, F05, Lec9, Liao CISC 667 Intro to Bioinformatics (Fall 2005) Sequence Database search Heuristic algorithms –FASTA –BLAST –PSI-BLAST.

Construction of Substitution Matrices

You have worked for 2 years to isolate a gene involved in axon guidance. You sequence the cDNA clone that contains axon guidance activity. What do you.

Protein Synthesis Occurs in 2 steps – Step 1: Transcription Taking DNA and transcribing it into RNA – Step 2: Translation Taking RNA and translating it.

Pattern Matching Rhys Price Jones Anne R. Haake. What is pattern matching? Pattern matching is the procedure of scanning a nucleic acid or protein sequence.

A Tutorial of Sequence Matching in Oracle Haifeng Ji* and Gang Qian** * Oklahoma City Community College ** University of Central Oklahoma.

Introduction to Bioinformatics Dr. Rybarczyk, PhD University of North Carolina-Chapel Hill

Basic Local Alignment Search Tool BLAST Why Use BLAST?

Database search. Overview ： 1. FastA ： is suitable for protein sequence searching 2. BLAST ： is suitable for DNA, RNA, protein sequence searching.

Construction of Substitution matrices

Bioinformatics zInterdisciplinary science that involves developing and applying information technology for analyzing biological data Overview of Bioinformatics.

Annotation of eukaryotic genomes

What is BLAST? Basic BLAST search What is BLAST?

BIOINFORMATICS Ayesha M. Khan Spring 2013 Lec-8.

Summer Bioinformatics Workshop 2008 BLAST Chi-Cheng Lin, Ph.D., Professor Department of Computer Science Winona State University – Rochester Center

SC.912.L.16.3 DNA Replication. – During DNA replication, a double-stranded DNA molecule divides into two single strands. New nucleotides bond to each.

BLAST: Basic Local Alignment Search Tool Robert (R.J.) Sperazza BLAST is a software used to analyze genetic information It can identify existing genes.

What is BLAST? Basic BLAST search What is BLAST?

Bacterial infection by lytic virus

Bioinformatics Overview

Bacterial infection by lytic virus

Basics of BLAST Basic BLAST Search - What is BLAST?

Bioinformatics Madina Bazarova. What is Bioinformatics? Bioinformatics is marriage between biology and computer. It is the use of computers for the acquisition,

생물정보학 Bioinformatics.

Have (y)Our Protein Explained

Step 1: amplification and cloning procedures

Genome Center of Wisconsin, UW-Madison

Bioinformatics and BLAST

Gene Annotation with DNA Subway

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Geneomics and Database Mining and Genetic Mapping

Comparative Genomics.

Bioinformatics Vicki & Joe.

What do you with a whole genome sequence?

Basic Local Alignment Search Tool

Different Genes ~ Protein Primary Structure

Practice Clone 3 Download and get ready!.

Basic Local Alignment Search Tool (BLAST)

Standard Mutation Nomenclature in Molecular Diagnostics

Evolution of Genomes Chapter 21.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Basic Local Alignment Search Tool

Common Errors in Student Annotation Submissions contributions from Paul Lee, David Xiong, Thomas Quisenberry Annotating multiple genes at the same locus.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Presentation transcript:

Bioinformatics On Genomics Hsueh-Fen Yuki Juan April 28, 2003

Outline Gene Sequence Searching Cutting Site for a Specific Sequence Sequence Alignment Search for Conserved Domains ORF Finding

Gene Sequence Searching Cutting Site for a Specific Sequence Sequence Alignment Search for Conserved Domains ORF Finding

Accession Number Gene Sequence Gene Sequence Searching

AA AA AA AA AA425102

GGGGGGGGGAAGCTGAGCGCTGAGACCAAGGGCTAAAGCTGGGAGACTGAAAAAATGCAG ACCGCCGGGGCATTATTCATTTCTCCAGCTCTGATCCGCTGTTGTACCAGGGGTCTAATC AGGCCTGTGTCTGCCTCCTTCTTGAATAGCCCAGTGAATTCATCTAAACAGCCTTCCTAC AGCAACTTCCCACTCCAGGTGGCCAGACGGGAGTTCCAGACCAGTGTTGTCTCCCGGGAC ATTGACACAGCAGCCAAGTTTATTGGTGCTGGGGCAGCCACAGTTGGTGTGGCTGGTTCA GGGGCTGGCATTGGAACCGTGTTTGGCAGCTTGATCATTGGCTATGCCAGGAACCCGTCT CTCAAGCAGCAGCTCTTCTCCTATGCCATTCTTGGCTTTGCCCTGTCTGAGGCCATGGGG CTTTTCTGTTTGATGGTCGCCTTCCTCATCCTCTTCGCCATGTGAGGCTCCATGGGGGGT CACCGGCCTGTTGCTACTGCAACTCCACACCATTCTTGGTGCTGGGGTGTGTTAAGCTTT ACCATTAAACACAACGTTTCTCTAAAAAAAAAAAAAAAAAAAAC

Gene Sequence Searching Cutting Site for a Specific Sequence Sequence Alignment Search for Conserved Domains ORF Finding

Cutting Site for a Specific Sequence Sequence Cut by Restriction Enzymes 1.RestrictionMapper 2.REBASE 3.NEBcutter 4.DARWIN

RestrictionMapper

REBASE Rebase.neb.com/ rebase.html

DARWIN WebGene/RE.html

Gene Sequence Searching Cutting Site for a Specific Sequence Sequence Alignment Search for Conserved Domains ORF Finding Primary Structure Analysis: Amino acid composition, pI and MW Protein Sequence Searching Proteomics Tools

Input Query Amino Acid Sequence DNA Sequence Blastptblastn blastn blastxtblastx Compares Against protein Sequence Database Compares Against Translated Nucleotide Sequence Database Compares Against Nucleotide Sequence Database Compares Against protein Sequence Database Compares Against Translated Nucleotide Sequence Database Sequence Alignment

BLAST

Copy Sequence

Pairwise BLAST

Gene Sequence Searching Cutting Site for a Specific Sequence Sequence Alignment Search for Conserved Domains ORF Finding

Search for Conserved Domains

Gene Sequence Searching Cutting Site for a Specific Sequence Sequence Alignment Search for Conserved Domains ORF Finding

ORF Finder (Open Reading Frame Finder)

Useful Bio-Websites euGene Proteome GeneCards