Bioinformatics: Computing Perspective Primary source: Beginning Perl for Bioinformatics by James Tisdall.

Slides:



Advertisements
Similar presentations
Linux for Dessert Experimenting with the Raspberry Pi Jeff Jirsa.
Advertisements

DNA Structure IB Topics 3 and 7.
Review Describe how chromosomes and DNA are related.
Introduction to Bioinformatics Yana Kortsarts Bob Morris.
1 Genetics The Study of Biological Information. 2 Chapter Outline DNA molecules encode the biological information fundamental to all life forms DNA molecules.
Algorithms and Problem Solving-1 Algorithms and Problem Solving.
Introduction to Bioinformatics Spring 2008 Yana Kortsarts, Computer Science Department Bob Morris, Biology Department.
Data-intensive Computing: Case Study Area 1: Bioinformatics B. Ramamurthy 6/17/20151.
Bioinformatics Lecture 2. Bioinformatics: is the computational branch of molecular biology Using the computer software to analyze biological data The.
Section 8.3: DNA Replication
Chapter 1 Program Design
Recap Don’t forget to – pick a paper and – me See the schedule to see what’s taken –
11 DNA and Its Role in Heredity. 11 The Structure of DNA DNA is a polymer of nucleotides. The four nucleotides that make up DNA differ only in their nitrogenous.
13.3: RNA and Gene Expression
Exploration Session Week 8: Computational Biology Melissa Winstanley: (based on slides by Martin Tompa,
C OMPUTATIONAL BIOLOGY. O UTLINE Proteins DNA RNA Genetics and evolution The Sequence Matching Problem RNA Sequence Matching Complexity of the Algorithms.
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
A brief Introduction to Bioinformatics Y. SINGH NELSON R. MANDELA SCHOOL OF MEDICINE DEPARTMENT OF TELEHEALTH Content licensed under.
Biology 9.3 Replication of DNA
Chapter 11: DNA and Genes (Part 1). 1. Although the environment influences how an organism develops, the genetic information that is held in the molecules.
Chapter 11 DNA and Genes Section 1 DNA: The Molecule of Heredity.
Date DNA. ✤ DNA stands for deoxyribonucleic acid ✤ DNA carries all the genetic information of living organisms.
DNA alphabet DNA is the principal constituent of the genome. It may be regarded as a complex set of instructions for creating an organism. Four different.
Directions: Press F5 at the top of the keyboard to begin PowerPoint
National 5 Biology Course Notes Part 4 : DNA and production of
CSCI 6900/4900 Special Topics in Computer Science Automata and Formal Grammars for Bioinformatics Bioinformatics problems sequence comparison pattern/structure.
Chemistry: An Introduction to General, Organic, and Biological Chemistry, Eleventh Edition Copyright © 2012 by Pearson Education, Inc. Chapter 17 Nucleic.
DNA Structure.
Chapter 11 DNA and GENES. DNA: The Molecule of Heredity DNA, the genetic material of organisms, is composed of four kinds nucleotides. A DNA molecule.
DNA It’s in our Genes!. DNA-What is it? DNA stands for deoxyribonucleic acid It is a nucleic acid that contains our genetic/hereditary information (located.
DNA, RNA, and Proteins Section 3 Section 3: RNA and Gene Expression Preview Bellringer Key Ideas An Overview of Gene Expression RNA: A Major Player Transcription:
Overview of Bioinformatics 1 Module Denis Manley..
Introduction to Bioinformatics Dr. Rybarczyk, PhD University of North Carolina-Chapel Hill
DNA Replication Section 9-3. DNA is Copied with the Help of Many Enzymes We know that the two DNA strands have a complementary relationship (A pairs with.
Chapter 9.3 Grade 10 Biology Spring 2011 The Replication of DNA.
Human Centric Computing (COMP106) Assignment 2 PROPOSAL 23.
Polynucleotides: DNA and RNA
Information Technology in the Natural Sciences Biology – Chemistry – Physics.
DNA Structure and Protein Synthesis (also known as Gene Expression)
Primary vs. Secondary Databases Primary databases are repositories of “raw” data. These are also referred to as archival databases. -This is one of the.
Bioinformatics Chem 434 Dr. Nancy Warter-Perez Computer Engineering Dr. Jamil Momand Chemistry & Biochemistry.
DNA- Deoxyribonucleic acid Each nucleotide of DNA is composed of a phosphate group, a sugar called deoxyribose and a molecule that is called a nitrogenous.
INVITATION TO Computer Science 1 11 Chapter 2 The Algorithmic Foundations of Computer Science.
Why do you think they are studying DNA????
General, Organic, and Biological Chemistry Copyright © 2010 Pearson Education, Inc.1 Chapter 21 Nucleic Acids and Protein Synthesis 21.3DNA Double Helix.
DNA. Unless you have an identical twin, you, like the sisters in this picture will share some, but not all characteristics with family members.
Program Design. Simple Program Design, Fourth Edition Chapter 1 2 Objectives In this chapter you will be able to: Describe the steps in the program development.
Gene Expression DNA, RNA, and Protein Synthesis. Gene Expression Genes contain messages that determine traits. The process of expressing those genes includes.
Prepared By: Syed Khaleelulla Hussaini. Outline Proteins DNA RNA Genetics and evolution The Sequence Matching Problem RNA Sequence Matching Complexity.
21.3 DNA Double Helix In the model shown, the sugar–phosphate backbone is represented by a ribbon with hydrogen bonds between complementary base pairs.
DNA Structure and Protein Synthesis (also known as Gene Expression)
Algorithms and Problem Solving
Data-intensive Computing: Case Study Area 1: Bioinformatics
Things that may help with comprehension of bioinformatics issues in general and Rosalind problems in particular.
DNA and The Genome Structure and Organisation of DNA
What is Bioinformatics?
Perl for Bioinformatics
DNA Replication Section 12-2
Algorithm Discovery and Design
Bioinformatics Vicki & Joe.
Genetics: From Genes to Genomes
The Study of Biological Information
DNA and the Genome Key Area 1a The Structure of DNA.
Algorithms and Problem Solving
= DNA Nucleotide Phosphate Nitrogen Base Pairs:
(Really) Basic Molecular Biology
An Overview of Gene Expression
Presentation transcript:

Bioinformatics: Computing Perspective Primary source: Beginning Perl for Bioinformatics by James Tisdall

Definition and Example [text] Bioinformatics is the application of computational tools and techniques to the management and analysis of biological data. [example] Does an interesting segment of mouse DNA hold a clue to the development of fatal brain tumors in humans?

more on the example After sequencing the DNA, you search online data sources using web-based sequence alignment tools. This gives some related sequences but not a direct match to the suspected link to brain tumors. However, public genetic databases are growing daily at a rapid rate. Checking daily would be best, and Perl allow you to do so, comparing the results to detect changes and ing you if there is a change.

Wikipedia definition (en.wikipedia.org) Bioinformatics and computational biology involve the use of techniques including applied mathematics, informatics, statistics, computer science, artificial intelligence, chemistry, and biochemistry to solve biological problems usually on the molecular level. Research in computational biology often overlaps with systems biology. Major research efforts in the field include sequence alignment, gene finding, genome assembly, protein structure alignment, protein structure prediction, prediction of gene expression and protein- protein interactions, and the modeling of evolution.applied mathematics informaticsstatisticscomputer scienceartificial intelligencechemistrybiochemistry biologicalmolecular systems biologysequence alignmentgene findinggenome assemblyprotein structure alignmentprotein structure predictiongene expressionprotein- protein interactionsevolution

Organization of DNA DNA is polymer composed of four molecules (called bases or nucleotides): adenine (A) [originally found in the glands] cytosine (C) [originally found in the cell] guanine (G) [originally found in guano] thymine (T) [originally found in the thymus] Bases joined end to end form a single strand of DNA.

More about DNA In the cell, DNA usually appears in a double-stranded form, with two strands wrapped around each other in a double helix shape. The two strands have matching bases, known as base pairs. An A on one matches with a T on the other, and a G is always paired with a C. Reverse complement is used to describe the relationship of the bases on the 2 strands.

Biological study types in vitro means “in glass” (test tube) in vivo means “in life” (living organism) in silico refers to biological studies done on the computer Experimental data to be collected, searched, and analyzed usually requires the use of computers to manage the information. Computer simulation is another important tool in studying important biological problems.

Perl Developed by Larry Wall in 1987 Popular language for bioinformatics and web programming Works well with ASCII text files (flat files) Designed to make it easy for one program to control other programs Supports rapid prototyping Portable

Larry Wall and Perl Wall continues to oversee further development of Perl and serves as the Benevolent Dictator for Life of the Perl project. His role in Perl is best conveyed by the so-called 2 Rules, taken from the official Perl documentation:Benevolent Dictator for Life Larry is always by definition right about how Perl should behave. This means he has final veto power on the core functionality. Larry is allowed to change his mind about any matter at a later date, regardless of whether he previously invoked Rule 1. Got that? Larry is always right, even when he was wrong.

Humor and Perl Wall along with Randal L. Schwartz and Tom Christiansen writing in the second edition of Programming Perl, outlined the Three Virtues of a Programmer:Randal L. SchwartzTom ChristiansenProgramming Perl Laziness - The quality that makes you go to great effort to reduce overall energy expenditure. It makes you write labor-saving programs that other people will find useful, and document what you wrote so you don't have to answer so many questions about it. Hence, the first great virtue of a programmer. Also hence, this book. See also impatience and hubris. Impatience - The anger you feel when the computer is being lazy. This makes you write programs that don't just react to your needs, but actually anticipate them. Or at least pretend to. Hence, the second great virtue of a programmer. See also laziness and hubris. Hubris - Excessive pride, the sort of thing Zeus zaps you for. Also the quality that makes you write (and maintain) programs that other people won't want to say bad things about. Hence, the third great virtue of a programmer. See also laziness and impatience.

Getting Perl Can be downloaded from Version on CSE machines (J251 and 263) is or will be on Linux and the vanilla open source version

Text appendices Appendix A – Resources Appendix B – Perl Summary (focusing on what is most useful for our purposes in this course)

Programming Edit – Run – Revise (and Save) Program Process –Identify required inputs –Design the program, usually an algorithm that computes the output from the inputs –How will output be handled? (display or file) –Refine the design with more detail –Write the Perl program code and revise until working correctly

Pseudocode and Code getanswer sub getanswer { print “Type in your answer here :”; my $answer = ; chomp $answer; return $answer: }

More pseudocode get the name of DNAfile from the user read in the DNA from the DNAfile for each regulatory element if element is in DNA, then add one to the count print count

Comments Comments are anything on a line after a # sign until the end of the line (only exception is the first line of many Perl programs, something like #!/usr/bin/perl)

Assignment Read Chapters 1-3 of Perl text and skim Appendices A and B at the back of the book Check out Get ready for Chapter 4