Plasmid Construction and Purification of Arabidopsis Plantacyanin and Lily Chemocyanin in a Prokaryotic System Suhyen Lee and Brooke Vuong (Aram Nersissian)

Slides:

Advertisements

Similar presentations

Section G Gene manipulation

Advertisements

Dolly the sheep ( ) 1. Animal and human cloning 2. Gene cloning.

Figure 5 Sample mobile shift assay gel. The 3 rd lane from the left shows a significant “shift” in the protein location, representing the proteins which.

Verify recombination by electrophoresis. Digest of rfp gene. Transform bacteria with recombinant plasmid. Recombination (ligation) of plasmid and rfp gene.

Chapter 4: recombinant DNA

TECHNIQUES IN ANSWERING BIOCHEMICAL QUESTIONS, WITH SPECIAL REFERENCE TO NUCLEIC ACIDS Larissa Assam (SUNY Oswego) Dr. Dhrubajyoti Chattopadhyay (University.

1. MOTIVATION Antibiotics are among the most frequently prescribed medications in modern medicine. However, there has been a decrease in the discovery.

Phuong Pham Dr. Gary Merrill Summer  Explore the functions of thioredoxin reductase  Only known enzyme to reduce thioredoxin  Recent research.

Cloning Vector Map.

Polymerase Chain Reaction - PCR The photocopier of molecular biology.

Measuring the persistence of MutS at a mismatch site after binding Nikki O’Donnell August 25, 2005 Department of Environmental and Molecular Toxicology.

Characterization of Metazoan Ceruloplasmin Ortholog in Chlamydomonas.

DNA Science Day 1 Amplifying and Cutting APh162 Winter 2005 Caltech.

Analysis of Gene Expression of Arabidopsis using RT-PCR and DNA Cloning Presented by Neha Jain ABE Workshop 2006 June 30, 2006.

Lab Exam 2 Overview. Bacterial Transformation To impart new phenotype by adding expressible genes Why use bacteria? – Rapid growth – Plasmids as vectors.

7.1 Techniques for Producing and Analyzing DNA SBI4UP MRS. FRANKLIN.

In Vivo assay for RNA-protein interactions Dana M. Schneider Loren Williams lab.

Principles and Processes

Construction, Transformation, and Prokaryote Expression of a Fused GFP and Mutant Human IL-13 Gene Sequence Lindsay Venditti, Department of Biological.

What causes LCA2 blindness?

DNA Technology- Cloning, Libraries, and PCR 17 November, 2003 Text Chapter 20.

DNA Technology Chapter 12. Applications of Biotechnology Biotechnology: The use of organisms to perform practical tasks for human use. – DNA Technology:

Manufacture of Human Interleukin 13 Protein Using a Prokaryotic Expression System Ryan Rupp, York College of Pennsylvania, Department of Biological Sciences.

Trends in Biotechnology

Section G Gene manipulation

歐亞書局 PRINCIPLES OF BIOCHEMISTRY Chapter 9 DNA-Based Information Technologies.

Plants respond to external stimuli through signal transduction pathways. An external signal binds the extracellular domain of a transmembrane receptor-like.

How do you identify and clone a gene of interest? Shotgun approach? Is there a better way?

DNA Cloning and PCR.

Today: Biotechnology. Over 600 recent transposon insertions were identified by examining DNA from 36 genetically diverse humans. Tbl 1 Which transposable.

Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week.

 Isolate a specific gene of interest  Insert into a plasmid  Transfer to bacteria  Grow bacteria to get many copies  Express the protein product 

Genetic Engineering. What is genetic engineering? Application of molecular genetics for practical purposes Used to – identify genes for specific traits.

Overview Amgen Biotech Labs In this set of labs, students will:

Cloning Genes Gene cloning: amplifying a specific piece of DNA via a bacteria cell Cloning vector: a replicating DNA molecule attached with a foreign DNA.

Recombinant DNA What is the basis of recombinant DNA technology? How does one “clone” a gene? How are genetically modified organisms (GMOs) created? Illustration.

AP Biology Biotech Tools Review AP Biology Biotech Tools Review  Recombinant DNA / Cloning gene  restriction enzyme, plasmids,

Neutrophil-specific Overexpression of FCHO2, a PCH family protein, in Danio rerio Chelsey Warning and Kate Cooper, PhD Loras College Department of Biology.

Molecular Genetic Technologies Gel Electrophoresis PCR Restriction & ligation Enzymes Recombinant plasmids and transformation DNA microarrays DNA profiling.

T9: Molecular Characterization of an Unknown P-element Insertion in Drosophila melanogaster.

Molecular Tools. Recombinant DNA Restriction enzymes Vectors Ligase and other enzymes.

Recombinant DNA Technology. DNA replication refers to the scientific process in which a specific sequence of DNA is replicated in vitro, to produce multiple.

Molecular Cloning.

MOLECULAR BIOLOGY IN ACTION In this project, students will use what they have learned in the previous courses to complete a larger multi-step molecular.

?. gfp-gene as cDNA in a host-DNA-fragment E. coli (new host)  gfp ? ??????? Aequorea victoria (donor) host.

Molecular Cloning. Definitions   Cloning :   Obtaining a piece of DNA from its original source (Genome) and introducing it in a DNA vector   Sub-cloning:

DNA Isolation. Nucleic Acid Structure & Function DNA & RNA are composed of Nucleotides A nucleotide consists of three covalently-linked parts: –A nitrogen.

Protein Overexpression in E. coli and

- making changes to the DNA code of a living organism.

Basic Tools: Recombinant DNA Techniques Cut Purified DNA with Restriction Enzymes Transform E. coli Purified plasmid DNA Various restriction enzymes T4.

RAD – technology overview Baird et al PLoS ONE.

Topics to be covers Basic features present on plasmids

Jeopardy Final Jeopardy Gene Cloning Plasmids Ligase PCR $100 $100

Chapter 7 Recombinant DNA Technology and Genomics

Accelerated Biology Transformation Lab

Lab 3: BUILDING THE pARA-R PLASMID

Cloning Overview DNA can be cloned into bacterial plasmids for research or commercial applications. The recombinant plasmids can be used as a source of.

Restriction Enzymes and Plasmid Mapping

Biotech Tools Review

Recombinant DNA Technology

Accelerated Biology Transformation Lab

Antibiotic resistance

Week 1: Tutorial Outline

Overview of Recombinant DNA Techniques

Cloning a DNA segment from bacteriophage

Abridged Genetic Engineering Pathway (Original “A” Sequence)

DEPARTMENT OF MICROBIOLOGY, S.M. JOSHI COLLEGE, HADAPSAR, PUNE

Template Switching by RNA Polymerase II In Vivo

Fig. 4 Dcr-2 binds to the 3′UTR of Toll mRNA.

Presentation transcript:

Plasmid Construction and Purification of Arabidopsis Plantacyanin and Lily Chemocyanin in a Prokaryotic System Suhyen Lee and Brooke Vuong (Aram Nersissian)

Outline Purpose Arabidopsis Plantacyanin Lily Chemocyanin Chemotropism Assay pET-3a vector Mechanism-Plasmid Construction -PCR Condition -DNA purification after PCR -DNA digestion and ligation -Transformation -Protein Purification

Purpose collaborate with UCR to purify protein so that UCR can use purified protein to do further research on Arabidopsis Plantacyanin and Lily Chemocyanin

A basic, 10kD, copper binding …..protein with pI ~10 Characterized by turning blue upon …..binding copper in its +2 oxidation …..state Its function remains unknown Has a single copper binding site …..formed by four ligands: two …..histidines and a cystein …..coordinate equatorially, while the …..fourth, axial ligand, is a …..methionine or a glutamine. The redox potential of plantacyanin …..bound copper varies with the …..hydrophobicity of the axial ligand: …..it increases along with the …..hydrophobicity of the ligand Arabidopsis Plantacyanin horticulture.tamu.edu/faculty/davies /students/ngo/research.html

A member of the plantacyanin family ….copper binding proteins Implicated in Chemotropism in lily ….stigma Essential in pollination: pollen tube ….chemotropism induction Shows 67% sequence similarity to ….plantacyanin Copper binding site: two histidines and ….a cysteine. In place of the axial ligand ….has a non-coordinating, hydrophobic ….leucine residue. Copper binding and other biochemical ….and biophysical properties have not ….been characterized. Lily Chemocyanin

Copyright ©2003 by the National Academy of Sciences Kim, Sunran et al. (2003) Proc. Natl. Acad. Sci. USA 100, Fig. 3. Chemotropism assay showing pollen tube reorientation over time (A and B) and quantification method (C)

pET-3a Vector *Designed for cloning and recombinant protein expressions in prokaryotic system, E. Coli. *Utilizes T7 RNA polymerase in the host cell to transcribe and translate. *Has NdeI and BamHI restriction sites which make directional cloning possible *Presence of selective marker, Ampicillin resistant gene

Plasmid Construction of Arabidopsis Plantacyanin Primers 1&3 Primer 1: AtPNCNdeMet1 gatcgacatatggccaagggaagaggcagtgc Primer 3: AtPNCNdeMet32 tacgttcatatggcaacgtacacggtcggtgactctgg Reverse Primer: AtPNCBamStop tagaggatccatcaaaccgcggtgactgcgattttc P32 P1

Plasmid Construction of Lily Chemocyanin Primer 2: lilChemNdeMet1 atctatcatatggctcagggaagtggcagtgcag Primer 4: lilChemNdeMet30 gtggcccatatggtcgtctataccgtcggcgatggc Reverse Primer: lilChemBamStop gagaggatccttaagctgctgtgactgctatcttcaaacc L30 L1

PCR Condition JRAY 94°C 2min 94°C 1min 50°C 1min 72°C 2min 72°C 10min 4°C 99hr N2 94°C 2min 94°C 1min 50°C 1min 72°C 4min 72°C 10min 4°C 99hr 30X *Reaction program Jray was the first program that I used. Using Jray program yielded product, yet the size of the DNA was incorrect. *Reaction program N2 is 60min longer than Jray and using this program yielded right size DNA

DNA Purification after PCR Agarose Gel Electrophoresis Low Melting Agarose Gel Electrophoresis Phenol-Chlorform Extraction Cold Ethanol Precipitation DNA is in aqueous phase in phenol-chloroform extraction After ethanol precipitation, DNA is in the pallet

DNA Digestion & Ligation Digest DNA with restriction enzyme, NdeI & BamHI with NEB buffer #2 Purify DNA After Restriction Digestion DNA Ligation with pET-3a vector

Transformation into Competent Cells

Conclusion *P1 expression produced large quantities of recombinant protein *No presence of protein for L1 *Protein in P1 can be purified via glucose shock then ultrafiltration *Protein in L30 should be purified via sonication, 8M urea treatment, and ultrafiltration

Protein Purification: Ultrafiltration of P1

Protein Purification: L30 purification

Further Research Purified proteins will be sent to University of California, Riverside for further study of Lily Chemocyanin

Acknowledgement First of all I want to thank God, Dr. Nersissian, Brooke Vuong, and Nicole. And I also want to thank Sam Phang, Penny Saephan, Phuong Minh and Nersissian Lab folks.