DNA Polymorphisms and Human Identification 1 Molecular Diagnostics

Polymorphism A DNA polymorphism is a sequence difference compared to a reference standard that is present in at least 1–2% of a population.  Polymorphisms can be single bases or thousands of bases.  Polymorphisms may or may not have phenotypic effects.2 Molecular Diagnostics

Polymorphic DNA Sequences Polymorphisms are found throughout the genome. If the location of a polymorphic sequence is known, it can serve as a landmark or marker for locating other genes or genetics regions. Each polymorphic marker has different versions or alleles.3 Molecular Diagnostics

Types of Useful Polymorphisms and Laboratory Methods4 Molecular Diagnostics

RFLP Typing Restriction fragment sizes are altered by changes in or between enzyme recognition sites.5 Molecular Diagnostics

RFLP Typing The presence of RFLP is inferred from changes in fragment sizes.6 Molecular Diagnostics

RFLP Typing7 Molecular Diagnostics

RFLP and Parentage Testing RFLP genotypes are inherited. For each locus, one allele is inherited from each parent. Southern blot band patterns8 Molecular Diagnostics

RFLP and Parentage Testing Who is the alleged father? Of the two alleged fathers shown, only one could supply the fragments not supplied by the mother.9 Molecular Diagnostics

Evidence Testing by RFLP Which suspect—S1 or S2—was at the crime scene? (V = victim, E = crime scene evidence, M = molecular weight standard) M S1 S2 V E M Locus 1 Locus 2 Locus 310 Molecular Diagnostics

Short Tandem Repeat Polymorphisms (STR) STR are repeats of nucleotide sequences.  AAAAAA… - mononucleotide  ATATAT… - dinucleotide  TAGTAGTAG… - trinucleotide  TAGTTAGTTAGT… - tetranucleotide  TAGGCTAGGCTAGGC… - pentanucleotide Different alleles contain different numbers of repeats.  TTCTTCTTCTTC - four repeat allele  TTCTTCTTCTTCTTC - five repeat allele11 Molecular Diagnostics

Short Tandem Repeat Polymorphisms STR alleles can be analyzed by fragment size (Southern blot). GTTCTAGCGGCCGTGGCAGCTAGCTAGCTAGCTGCTGGGCCGTGG CAAGATCGCCGGCACCG TCGATCGATCGATCGACGACCCGGCACC One repeat unit tandem repeat Restriction site Allele 1 GTTCTAGCGGCCGTGGCAGCTAGCTAGCTGCTGGGCCGTGG CAAGATCGCCGGCACCG TCGATCGATCGACGACCCGGCACC Allele 2 Allele M 1 2 M12 Molecular Diagnostics

Short Tandem Repeat Polymorphisms STR alleles can also be analyzed by amplicon size (PCR).13 Molecular Diagnostics

Short Tandem Repeat Polymorphisms Allelic ladders are standards representing all alleles observed in a population. (Allelic ladder) 11 repeats 5 repeats Genotype: 7,9 Genotype: 6,814 Molecular Diagnostics

Short Tandem Repeat Polymorphisms Multiple loci are genotyped in the same reaction using multiplex PCR. Allelic ladders must not overlap in the same reaction.15 Molecular Diagnostics

Short Tandem Repeat Polymorphisms by Multiplex PCR FGA TPOX D8S1179 vWA PentaE D18S51 D2S11 THO1 D3S Molecular Diagnostics

STR Nomenclature The International Society for Forensic Genetics recommended nomenclature for STR loci in 1997:  STRs within genes are designated according to the gene name (no phenotypic effect with respect to these genes): TH01 is in intron 1 of the human tyrosine hydroxylase gene on chromosome 11  Non–gene associated STRs are designated by the D#S# system: D stands for DNA The following number designates the chromosome where the STR is located (1-22, X or Y). S refers to a unique segment, followed by a number registered in the International Genome Database (GDB).

Gender Identification: Amelogenin Locus, HUMAMEL The amelogenin locus is not an STR (but along with STR). The HUMAMEL gene codes for amelogenin-like protein.  located on the X (Xp22.1–22.3) and Y chromosomes  required for embryonic development and tooth maturation Polymorphism is located in the second intron of the amelogenin gene:  X allele = 212 bp  Y allele = 218 bp (longer) 18Molecular Diagnostics Females (X, X) Homozygous (1 band) Males (X, Y) Heterozygous (2 bands)

Analysis of STR PCR Test Results: STR genotypes are analyzed using gel or capillary gel electrophoresis. Genotype: 7,9 11 repeats 5 repeats 11 repeats 5 repeats (Allelic ladder) 19Molecular Diagnostics

Identity testing by STR-PCR Genetic concordance: is a term used where all locus genotypes (alleles) from two sources are the same.  Concordance is interpreted as inclusion of a single individual as the donor of both genotypes.  Two samples are considered different if at least one locus genotype differs (exclusion). A matching genotype is not necessarily an absolute determination of identity of an individual. A microvariant allele (15.2) migrates between the full-length alleles

Child and parent are not necessarily in complete Genetic concordance  Mutational events may generate a new allele in the offspring, and this difference may not rule out paternity. Parentage Testing by STR-PCR 21Molecular Diagnostics Child Mother Father Which alleged father’s genotype has the paternal alleles?

Short Tandem Repeat Polymorphisms: Y-STR The Y chromosome is inherited in a block without recombination (Y chromosome cannot exchange information) STR on the Y chromosome are inherited paternally as a haplotype.  Series of linked alleles always inherited together  Thus, marker alleles on the Y chromosome are inherited from generation to generation in a single block. Y haplotypes are used for exclusion and paternal lineage analysis.  Except for rare mutation events, every male member of a family (brothers, uncles, cousins, and grandparents) will have the same Y-chromosome haplotype. 22Molecular Diagnostics

Engraftment Testing Using DNA Polymorphisms Allogeneic donor and recipient immune compatibility is tested prior to the transplant by HLA typing. Sequence polymorphisms (alleles) in the HLA locus are compared with those of the recipient to determine which donor would be most tolerated by the recipient immune system. Donors may be known or related to the patient or anonymous unrelated contributors (matched unrelated donor). Recipient receives his or her own purged cells Recipient receives donor cells A recipient with donor marrow is a chimera.

Chimerism Testing Using STR There are two parts to chimerism testing: pretransplant informative analysis and post- transplant engraftment analysis  donor cells can be monitored by following donor polymorphisms in the recipient blood and bone marrow Before transplant DonorRecipient After transplant Complete (Full) Mixed Graft failure 24Molecular Diagnostics

Chimerism Testing Using STR: Informative Analysis STR are scanned to find informative loci (donor alleles differ from recipient alleles).  Noninformative loci: the donor and the recipient have the same alleles.  Donor-informative loci: donor and recipient share one allele, and the donor has a unique allele.  Recipient informative loci: the unique allele is in the recipient Full chimerism: only the donor alleles are detected in the recipient Mixed chimerism: a mixture of donor and recipient alleles are present Graft failure: only recipient alleles are detectable 25Molecular Diagnostics

Which loci are informative? 26Molecular Diagnostics GF: graft failure MC: mixed chimerism FC: full chimerism vWA TH01 Amel TPOX CSF1PO

Chimerism Testing Using STR: Engraftment Analysis Using informative loci, peak areas are determined in fluorescence units or from densitometry scans of gel bands.  A(R) = area under recipient-specific peaks  A(D) = area under donor-specific peaks A(D) A(R) A(R) + A(D) 27Molecular Diagnostics % Recipient DNA = A(R) + A(D) A(R) × 100 % Recipient DNA = A(R) + A(D) A(R) × 100

Chimerism Analysis of Cellular Subsets Cell subsets (T cells, granulocytes, NK cells, etc.) engraft with different kinetics. Analysis of cellular subsets provides a more detailed description of the engrafting cell population. Analysis of cellular subsets also increases the sensitivity of the engraftment assay. 28Molecular Diagnostics

Chimerism Analysis of Cellular Subsets T cells (CD3), NK cells (CD56), granulocytes, myeloid cells (CD13, CD33), myelomonocytic cells (CD14), B cells (CD19), stem cells (CD34) Methods  Flow cytometric sorting  Immunomagnetic cell sorting  Immunohistochemistry + XY FISH 29Molecular Diagnostics

R D T G R = Recipient alleles D = Donor alleles T = T-cell subset (mostly recipient) G = Granulocyte subset (mostly donor) Chimerism Analysis of Cellular Subsets Detection of different levels of engraftment in cellular subsets is split chimerism. 30Molecular Diagnostics

Single Nucleotide Polymorphisms (SNP) Single-nucleotide differences between DNA sequences. One SNP occurs approximately every 1,250 base pairs in human DNA. SNPs are detected by sequencing, melt curve analysis, or other methods. 99% have no biological effect; 60,000 are within genes. 31Molecular Diagnostics

5′ AGTCTG5′ AG(T/A)CTG5′ AGACTG T/T T/A A/A SNP Detection by Sequencing 32Molecular Diagnostics

SNP Haplotypes SNPs are inherited in blocks or haplotypes.  Sections of DNA along chromosomes can be inherited as a unit or block of sequence  No recombination occurs within the block.  All the SNPs on that block comprise a haplotype. SNPs can be used for mapping genes, human identification, chimerism analysis, and many other applications. 33Molecular Diagnostics