Next Generation Microarray Technology: Overview of Febit’s Geniom One ® H. Bjørn Nielsen Center for Biological Sequence analysis Technical University of.

Slides:

Advertisements

Similar presentations

Chromatin Immunoprecipitation and the Chip on Chip technique. Fredrik Fagerström Billai B E A- Core Facility for Bioinformatics and Expression Analysis.

Advertisements

Application of available statistical tools Development of specific, more appropriate statistical tools for use with microarrays Functional annotation of.

Modeling sequence dependence of microarray probe signals Li Zhang Department of Biostatistics and Applied Mathematics MD Anderson Cancer Center.

Biochemistry April Lecture DNA Microarrays.

Transcriptome Sequencing with Reference

1 Institute for Systems Biology Enabling new genomics technologies in the ISB Microarray Facility B. Marzolf 1, P. Troisch 1 Multiple platforms support.

Introduction to DNA Microarray Technology Steen Knudsen, April 2005.

Molecular Biology Primer

Probe design for microarrays using OligoWiz Rasmus Wernersson, Assistant Professor Center for Biological Sequence Analysis Technical University of Denmark.

Introduction to DNA Microarrays Todd Lowe BME 88a March 11, 2003.

Chip arrays and gene expression data. With the chip array technology, one can measure the expression of 10,000 (~all) genes at once. Can answer questions.

Probe design for microarrays using OligoWiz. Sample Preparation Hybridization Array design Probe design Question Experimental Design Buy Chip/Array Statistical.

Chip arrays and gene expression data. Motivation.

DNA Arrays …DNA systematically arrayed at high density, –virtual genomes for expression studies, RNA hybridization to DNA for expression studies, –comparative.

Central Dogma 2 Transcription mRNA Information stored In Gene (DNA) Translation Protein Transcription Reverse Transcription SELF-REPAIRING ARABIDOPSIS,

Modeling Functional Genomics Datasets CVM Lesson 1 13 June 2007Bindu Nanduri.

Microarrays: Theory and Application By Rich Jenkins MS Student of Zoo4670/5670 Year 2004.

Introduce to Microarray

Introduction to DNA microarrays DTU - January Hanne Jarmer.

Genomics I: The Transcriptome RNA Expression Analysis Determining genomewide RNA expression levels.

Microarrays: Basic Principle AGCCTAGCCT ACCGAACCGA GCGGAGCGGA CCGGACCGGA TCGGATCGGA Probe Targets Highly parallel molecular search and sort process based.

and analysis of gene transcription

with an emphasis on DNA microarrays

Molecular Biology Dr. Chaim Wachtel April 4, 2013.

Affymetrix vs. glass slide based arrays

‘Omics’ - Analysis of high dimensional Data

Experimental Design and Setup. Experimental Design What is the question? Which experiments will give the answer? How many replicates do we need?

The virochip (UCSF) is a spotted microarray. Hybridization of a clinical RNA (cDNA) sample can identify specific viral expression.

Introduction to DNA Microarray Technology Steen Knudsen Uma Chandran.

The Genome is Organized in Chromatin. Nucleosome Breathing, Opening, and Gaping.

Affymetrix GeneChips and Analysis Methods Neil Lawrence.

Data Type 1: Microarrays

The Center for Medical Genomics facilitates cutting-edge research with state-of-the-art genomic technologies for studying gene expression and genetics,

Introduction to DNA microarrays DTU - May Hanne Jarmer.

Dr Andrew Harrison Departments of Mathematical Sciences and Biological Sciences University of Essex Looking for signals in tens of thousands.

Vidyadhar Karmarkar Genomics and Bioinformatics 414 Life Sciences Building, Huck Institute of Life Sciences.

Doug Brutlag 2011 Genomics, Bioinformatics & Medicine Doug Brutlag Professor Emeritus of.

Lawrence Hunter, Ph.D. Director, Computational Bioscience Program University of Colorado School of Medicine

Microarrays and Gene Expression Analysis. 2 Gene Expression Data Microarray experiments Applications Data analysis Gene Expression Databases.

Molecular Biology Dr. Chaim Wachtel May 28, 2015.

Transcriptome analysis of the TnrA regulon in Bacillus subtilis Hanne Jarmer Center for Biological Sequence analysis Technical University of Denmark.

Genomics I: The Transcriptome

GeneChip® Probe Arrays

MICROARRAY TECHNOLOGY

Introduction to Microarrays.

DTU - January Hanne Jarmer

Alistair Chalk, Elisabet Andersson Stem Cell Biology and Bioinformatic Tools, DBRM, Karolinska Institutet, September Day 5-2 What bioinformatics.

Lecture 6. Functional Genomics: DNA microarrays and re-sequencing individual genomes by hybridization.

Starting Monday M Oct 29 –Back to BLAST and Orthology (readings posted) will focus on the BLAST algorithm, different types and applications of BLAST; in.

Analysis of protein-DNA interactions with tiling microarrays

Idea: measure the amount of mRNA to see which genes are being expressed in (used by) the cell. Measuring protein might be more direct, but is currently.

Microarray (Gene Expression) DNA microarrays is a technology that can be used to measure changes in expression levels or to detect SNiPs Microarrays differ.

Gene expression & Clustering. Determining gene function Sequence comparison tells us if a gene is similar to another gene, e.g., in a new species –Dynamic.

Introduction to Microarrays. The Central Dogma.

Overview of Microarray. 2/71 Gene Expression Gene expression Production of mRNA is very much a reflection of the activity level of gene In the past, looking.

Proteome and Gene Expression Analysis Chapter 15 & 16.

ANALYSIS OF GENE EXPRESSION DATA. Gene expression data is a high-throughput data type (like DNA and protein sequences) that requires bioinformatic pattern.

Lecture 23 – Functional Genomics I Based on chapter 8 Functional and Comparative Genomics Copyright © 2010 Pearson Education Inc.

Disease Diagnosis by DNAC MEC seminar 25 May 04. DNA chip Blood Biopsy Sample rRNA/mRNA/ tRNA RNA RNA with cDNA Hybridization Mixture of cell-lines Reference.

Microarrays and Other High-Throughput Methods BMI/CS 576 Colin Dewey Fall 2010.

DNA Microarray Overview and Application. Table of Contents Section One : Introduction Section Two : Microarray Technique Section Three : Types of DNA.

Transcriptome What is it - genome wide transcript abundance How do you obtain it - Arrays + MPSS What do you do with it when you have it - ?

Biochemistry April Lecture DNA Microarrays.

The State of Microarrays The Scientist: 2003 By: Hien Dang.

From: Duggan et.al. Nature Genetics 21:10-14, 1999 Microarray-Based Assays (The Basics) Each feature or “spot” represents a specific expressed gene (mRNA).

Introduction to Oligonucleotide Microarray Technology

Microarray: An Introduction

The Central Dogma. Life - a recipe for making proteins DNA protein RNA Translation Transcription.

Microarray Technology and Applications

Introduction to Microarrays.

Presentation transcript:

Next Generation Microarray Technology: Overview of Febit’s Geniom One ® H. Bjørn Nielsen Center for Biological Sequence analysis Technical University of Denmark NORFA 2004 course Lo-skolen - May 21

Microarrays - The Technologies Stanford microarrays Affymetrix Febit Affymetrix Febit Stanford microarrays

aRNA Design Probes Import into Geniom One ® Over Night Synthesis Chip SAMPLE KONTROL FEBIT

The Technologies - Costs Facility setup cost: Stanford microarrays < 1 mill kr Affymetrix< 2 mill kr Febit< 2.5 mill kr Cost pr. transcript: Stanford microarrays < 0.5 kr Affymetrix< 0.5 kr Febit< 2.5 kr

The Technologies - Flexibility Stanford microarrays: Are flexible, but new probes must be ordered each time Affymetrix arrays: Are not flexible Febit arrays: Are highly flexible, the probes are synthesized over night inside Geniom One ® from an imported template file

The Technologies - Data Quality Reproducibility of data - the pearson correlation Stanford microarrays: Affymetrix: > 0.95 Febit:> 0.95

The Technologies - Choice of Stanford microarrays: If you work with a limited number of species - maybe not yet sequenced - inexpensive - variable data quality Affymetrix: If you work with “standard” species - expensive - high quality of data Febit: If you work with many different species with available sequence information and/or wishes to perform iterative experiments - expensive - high quality of data

8 arrays with 6,776 probes >54,000 probes pr. processor The Geniom One ® Processor

Photolithography - Micromirrors

TTT T T T T T T T A A A A A A A AAA Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups Mask #1 Mask #2

Output from Geniom one

A Febit experiment - Goal and Idea Find all Transcription Start Sites (TSSs) in B. subtilis - We do this by the use of the Geniom One ® - A two-step method: - Dichotomy - Pin-point

1. The Dichotomy Method 2. run: 3. run: 4. run: run: bp between probes covering all intergenic regions in the genome

The Problem of Tiling +1 Intensity Position

Castle et al., Genome Biol. 2003; 4 (10): R66 Genome studies, Bioinformatics, Methods, Genetics Probe-Intensity Profiles for Intron-Exon Boundaries Tiling of 35 mers

We Need Increased Specificity We know from physical chemistry that: DNA:DNA and RNA:DNA hybridizations are destabilized by mismatches or gaps, and that this is less pronounced for distal positions. Position Contribution to stability Surface end Middle Solution end

fragmentation Geniom ® one The Pin-point Method

ATATAGGAGG TATAGGAGGA ATAGGAGGAT TAGGAGGATC CCAGGTAC TTCAATATAGGAGGATCATATGCCAG The Pin-point Method Probes

The Hole Expressome? - What RNA should we use? - Analyzed existing microarray data - Found that most genes were represented in: - Heat shock experiment - 4 different time points in minimal medium

Transcription - What will we see? - How pronounced are the “holes” between the genes ??????

Labeling of the RNA - Two types of labeling: - 5’ label after fragmentation - 5’ label before fragmentation

Acknowledgements Hanne Ø. Jarmer Hanni Willenbrock Steen Knudsen Hans Henrik Saxild Kristine Bøje Dahlin