A Computational Analysis of the H Region of Mouse Olfactory Receptor Locus 28 Deanna Mendez SoCalBSI August 2004.

Slides:



Advertisements
Similar presentations
Annotation standards in ORegAnno (Draft) Obi Griffith The RegCreative Jamboree Nov 29, 2006 Ghent, Belgium.
Advertisements

© Wiley Publishing All Rights Reserved. Using Nucleotide Sequence Databases.
Outline Questions from last lecture? P. 40 questions on Pax6 gene Mechanism of Transcription Activation –Transcription Regulatory elements Comparison between.
Combined analysis of ChIP- chip data and sequence data Harbison et al. CS 466 Saurabh Sinha.
Finding regulatory modules from local alignment - Department of Computer Science & Helsinki Institute of Information Technology HIIT University of Helsinki.
Comparative genomics Joachim Bargsten February 2012.
A Novel Multigene Family May Encode Odorant Receptors: A Molecular Basis for Odor Recognition Linda Buck and Richard Axel Published in Cell, Volume 65,
Visualization of genomic data Genome browsers. UCSC browser Ensembl browser Others ? Survey.
Southern California Bioinformatics Summer Institute Wendie Johnston, Beverly Krilowicz, Jamil Momand, Sandra Sharp, Nancy Warter- Perez.
A Genomic Survey of Polymorphism and Linkage Disequilibrium Imran Mohiuddin Magnus Nordborg, Ph.D. University of Southern California.
Visualization of genomic data Genome browsers. How many have used a genome browser ? UCSC browser ? Ensembl browser ? Others ? survey.
Some new sequencing technologies. Molecular Inversion Probes.
Detecting Orthologs Using Molecular Phenotypes a case study: human and mouse Alice S Weston.
Microarrays and Cancer Segal et al. CS 466 Saurabh Sinha.
Genome Browsers Ensembl (EBI, UK) and UCSC (Santa Cruz, California)
The Model To model the complex distribution of the data we used the Gaussian Mixture Model (GMM) with a countable infinite number of Gaussian components.
Genomic Database - Ensembl Ka-Lok Ng Department of Bioinformatics Asia University.
Gene Discovery & Genome Browsing
[Bejerano Fall09/10] 1 Milestones due today. Anything to report?
Defining the Regulatory Potential of Highly Conserved Vertebrate Non-Exonic Elements Rachel Harte BME230.
Genome Browsers UCSC (Santa Cruz, California) and Ensembl (EBI, UK)
ViaLogy Lien Chung Jim Breaux, Ph.D. SoCalBSI 2004 “ Improvements to Microarray Analytical Methods and Development of Differential Expression Toolkit ”
Visualization of genomic data Genome browsers. UCSC browser Ensembl browser Others ? Survey.
Bioinformatics Genome anatomy Comparisons of some eukaryotic genomes Allignment of long genomic sequences Comparative genomics Oxford Grid Reconstruction.
Genetic Effects of Stress in Vervet Monkey Olivera Grujic Dr. Eleazar Eskin’s Lab, UCLA Dr. Nelson Freimer’s Lab,UCLA SoCalBSI, 2008.
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
Genome-wide mapping of transcription factor Oct4, Sox2 and Nanog binding-sites in mouse embryonic stem cells Genome Institute of Singapore Department of.
P300 Marks Active Enhancers Ruijuan LiChao HeRui Fu.
An Introduction to ENCODE Mark Reimers, VIPBG (borrowing heavily from John Stamatoyannopoulos and the ENCODE papers)
Generic substitution matrix -based sequence similarity evaluation Q: M A T W L I. A: M A - W T V. Scr: 45 -?11 3 Scr: Q: M A T W L I. A: M A W.
Regulation of Gene Expression: An Overview  Transcriptional  Tissue-specific transcription factors  Direct binding of hormones, growth factors, etc.
UCSC Genome Browser 1. The Progress 2 Database and Tool Explosion : 230 databases and tools 1996 : first annual compilation of databases and tools.
발표자 석사 2 년 김태형 Vol. 11, Issue 3, , March 2001 Comparative DNA Sequence Analysis of Mouse and Human Protocadherin Gene Clusters 인간과 마우스의 PCDH 유전자.
20.1 Structural Genomics Determines the DNA Sequences of Entire Genomes The ultimate goal of genomic research: determining the ordered nucleotide sequences.
Aim: To understand how the olfactory transduction system is organized Are there several receptor protein “species” each of which detect a class of odorant.
COURSE OF BIOINFORMATICS Exam_31/01/2014 A.
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
Browsing the Genome Using Genome Browsers to Visualize and Mine Data.
Web Databases for Drosophila Introduction to FlyBase and Ensembl Database Wilson Leung6/06.
Identification of Compositionally Similar Cis-element Clusters in Coordinately Regulated Genes Anil G Jegga, Ashima Gupta, Andrew T Pinski, James W Carman,
Bioinformatic Tools for Comparative Genomics of Vectors Comparative Genomics.
Starting Monday M Oct 29 –Back to BLAST and Orthology (readings posted) will focus on the BLAST algorithm, different types and applications of BLAST; in.
MEME homework: probability of finding GAGTCA at a given position in the yeast genome, based on a background model of A = 0.3, T = 0.3, G = 0.2, C = 0.2.
Tools for Comparative Sequence Analysis Ivan Ovcharenko Lawrence Livermore National Laboratory.
How do we represent the position specific preference ? BID_MOUSE I A R H L A Q I G D E M BAD_MOUSE Y G R E L R R M S D E F BAK_MOUSE V G R Q L A L I G.
Accessing and visualizing genomics data
Transcription factor binding motifs (part II) 10/22/07.
Genomes at NCBI. Database and Tool Explosion : 230 databases and tools 1996 : first annual compilation of databases and tools lists 57 databases.
Finding Motifs Vasileios Hatzivassiloglou University of Texas at Dallas.
PROTEIN INTERACTION NETWORK – INFERENCE TOOL DIVYA RAO CANDIDATE FOR MASTER OF SCIENCE IN BIOINFORMATICS ADVISOR: Dr. FILIPPO MENCZER CAPSTONE PROJECT.
Visualization of genomic data Genome browsers. How many have used a genome browser ? UCSC browser ? Ensembl browser ? Others ? survey.
A high-resolution map of human evolutionary constraints using 29 mammals Kerstin Lindblad-Toh et al Presentation by Robert Lewis and Kaylee Wells.
1 From Bi 150 Lecture 0 October 4, 2012 An introduction to molecular biology... but you will learn the cell biology in this course.
Graduate Research with Bioinformatics Research Mentors Nancy Warter-Perez, ECE Robert Vellanoweth Chem and Biochem Fellow Sean Caonguyen 8/20/08.
Enhancers and 3D genomics Noam Bar RESEARCH METHODS IN COMPUTATIONAL BIOLOGY.
Bos taurus Olfactory Receptor Katie Davis 1,2 and Sandra Rodriguez-Zas 1 1 Department of Animal Sciences, University of Illinois Urbana-Champaign, 2 ACES.
STAT115 STAT215 BIO512 BIST298 Introduction to Computational Biology and Bioinformatics Spring 2016 Xiaole Shirley Liu.
1 Bioinformatics Tools for Genotyping Frances Tong Dr. Garry Larson, Ph.D City of Hope Department of Molecular Medicine Southern California Bioinformatics.
Visualizing Biosciences Genomics & Proteomics. “Scientists Complete Rough Draft of Human Genome” - New York Times, June 26, 2000 The problem: –3 billion.
Genome Projects Maps Human Genome Mapping Human Genome Sequencing
Relationship between Genotype and Phenotype
Overview Bioinformatics: Analyzing biological data using statistics, math modeling, and computer science BLAST = Basic Local Alignment Search Tool Input.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Ensembl Genome Repository.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Alignment of distal NOS2 promoters from cattle, human, and sheep, and the Bov-A2 element. Alignment of distal NOS2 promoters from cattle, human, and sheep,
lincRNAs: Genomics, Evolution, and Mechanisms
Relationship between Genotype and Phenotype
Problems from last section
The Bov-A2 element is conserved in the NOS2 gene of bovid species.
Presentation transcript:

A Computational Analysis of the H Region of Mouse Olfactory Receptor Locus 28 Deanna Mendez SoCalBSI August 2004

Overview Background of olfactory receptors Introduce the H region as a possible cis regulatory element Define cis regulatory elements Results of looking for the H region Discussion of other possibile explanations of H Future work Acknowledgements References

Background of Olfactory Receptors A single odorant receptor gene is expressed by an olfactory neuron and that the axonal projections map to different glomeruli on the olfactory bulb. In 2003 a region of homology called the H region was identified as a putative cis regulatory element of the a particular set of olfactory receptors – MOR28 and their orthologous counterparts in humans. ORPseudogenes Mouse150020% Human90063% Dog83818%

Sample Olfactory Receptor Locus: Mor28 Mouse and Human Model Conserved 1.6kb region Without the H region there is little or no expression of ORs Sakano et al kb150kb

Cis acting elements A Cis acting elements are a sequence of DNA that can bind transcription factors and in so doing, control or modulate the level of transcriptional initiation from one or more nearby genes. 6 BLAST and Blat –whole genome view –across genome view Family Relations –local view of DNA Sakano

Dot Plot: Human and Mouse Mouse Human

Pair view of Mouse and Human H region aligned at a 85% threshold Family Relations This diagram shows the region of similarity in the dot plot. The area of high conservation is about 300 base pairs. Human Mouse

Dot Plot 95% similiarity Seeing that the region of 300 basepairs was well conserved it became my probe for detecting new H regions. Mouse Human

Need for a node in the evolutionary Tree to obtain more general information Dog Genome was released, assembled, and made publically available in July To find an orthologous region in dog I used the three known olfactory receptors in mouse and blasted them to the dog genome and then looked for the gene upstream of the H region in mouse in the dog genome. Unrooted evolutionary tree showing the relationship of Mouse, Human, and Dog. Science 2003

Mor28 Mor10 Mor83 15: : : The BLAST result of Mor28 Locus on the Dog Genome

Orthologous Mor28 site in Dog

2kb H region of mouse BLASTED on the dog genome Subject: kb

300bp H region from Mouse(32) on Dog

Three way of comparison of Mouse, Human, and Dog Mouse chr14 Human chr14 Dog chr8 Mouse vs Human Human vs Dog Mouse vs Dog Mouse vs Human vs Dog

Another possibility Mouse chr14:45,151,208-45,463,207 The 300 base pairs.

Future Work Wet Experiment: Test the H region to see if it is a general enhancer. Dry experiments: Look at the other candidate homologous sequences

Acknowledgments Barbara Wold for giving me the opportunity to work in her lab and for her directing my work. Joe Roden for his time and enthusiasm for this project. Jamil Momand, Nancy Warter-Perez, Wendie Johnston, Sandra Sharp for making this program possible. Tim Ng and my fellow interns. NSF and NIH for funding this summer program.

References 1.Buck L, Axel R. (1991) A novel multigene family may encode odorant receptors: a molecular basis for odor recognition.Cell. 65, Galibert, F et al. (2003) Comparison of the canine and human olfactory receptor gene repertoires.Genome Biology 4, 12 3.Sakano, H. et al. (2001) Monoallelic expresion of the odourant receptor gene and axonal projection of olfactory sensory neurones. Genes to Cells. 6, Sakano, H. et al. (2003) Negative Feedback Regulation Ensures the One Receptor–One Olfactory Neuron Rule in Mouse. Science. 302, Kirkness E, Bafna V, Halpern A, Levy S, Remington K, Rusch D, Delcher A, Pop M, Wang W,Fraser C, Venter C. (2003) The Dog Genome: Survey Sequencing and Comparative Analysis. Science, 301, UCSC Genome Browser: 7.NCBI: 8.Ensembl: 9.Family Relations: