Construction of Reporter Luciferase Genes to Assess NOC4 expression Finding the Promoter Region of the NOC4 Gene. Nicholas Simon Faculty Sponsor: Nancy Bachman

Overview  Luciferase Vectors  Mutagenesis Strategy  Bioinformatics  Mutagenesis  Transformation  DNA Sequencing  Reporter Assays

Luciferase Vectors  Vectors have four features  they are able to replicate  they have selectable markers  foreign DNA can be inserted in them  they often carry a reporter gene

Luciferase Vectors

Mutagenesis Strategy  Point Mutations or Deletions? Point mutation in a region of 250bp – need 30 primers Deletion in a region of 250bp – need only 6 primers Issues: Cost and Saturation Deletion was Best

Deletions  cttctctatcgataggtaccgagctcttacgcgtaggtaccgagctcttacgcgtg cggccgcgggctggcgggggacccttcaggcccggccccgtttgggcctcggct cctggaaaagcgactcgcgcctctgggaagccgcagccccagactccagtcgc gcttctcgcccggcgccgccggaaagcagcctctccaacgcctgccggaaagc agcccggcccggcattttacgacgttcgcagcgctacccttttccgctccacggtg acctccgtgcggccgggtgcgggcggagtcttcctcgatcccgtggtgctccgcg gcgcggccttgctctcttccgggggctcgagatctgcgatctaagtaagcttggc att  tttctctatcgataggtaccgagctcttacgcgtaggtaccgagctcttacgcgtg cggccgcgggctggcgggggacccttcaggcccggccccgtttgggcctcggct cctggaaaagcgactcgcgcctctgggaagccgcagccccagactccagtcgc gcttctcgcccggcgccgccggaaagcagcctctccaacgcctgccggaaagc agcccggcccggcattttacgacgttcgcagcgctacccttttccgctccacggtg acctccgtgcggccgggtgcgggcggagtcttcctcgatcccgtggtgctccgcg gcgcggccttgctctcttccgggggctcgagatctgcgatctaagtaagcttggc att

General Strategy

Bioinformatics  Used to design primers Minimize secondary structures

 Denature the DNA template  Anneal the primers  Synthesize the mutant strand

DNA Sequencing  Purify the Vector DNA from E. coli  Cycle DNA sequencing

Reporter Assays  Transfect the DNA vector into HeLa cells  Wait for 24 hours so cell will express the luciferase  Then measure luciferase activity

And What Happens If No Expression?