Polymorphism discovery informatics Gabor T. Marth Department of Biology Boston College Chestnut Hill, MA 02467
Types of sequence variations Substitution-type single-nucleotide polymorphisms are the most abundant form of sequence variations Various insertion-deletion type polymorphisms (INDELs) are also very common
Are all substitutions SNPs? systematic pattern of bi-allelism within the population examined
What is SNP discovery? comparative analysis of multiple sequences from the same region of the genome (redundant sequence coverage) includes the organization of sequences relative to each other, and determining if sequence differences are sequencing artifacts or true polymorphisms ?
Steps of SNP discovery Sequence clustering Paralog identification (cluster refinement) Multiple alignment SNP detection
SNP discovery in diverse sequences many different types of sequences are available for polymorphism discovery EST WGS BAC BAC-end genome restriction fragments different sequence types are radically different in terms of their accuracy genome sequence: 99.9 – 99.99% single pass sequence: 98-99% early methods of SNP discovery focused on specific sequence types
General SNP mining – PolyBayes sequence clustering simplifies to database search with genome reference paralog filtering by counting mismatches weighed by quality values multiple alignment by anchoring fragments to genome reference SNP detection by differentiating true polymorphism from sequencing error using quality values
SNP validation Direct re-sequencing African Asian Caucasian Hispanic CHM 1 Pooled sequencing Validation experiments show that the SNP probability or SNP score is accurate The SNP score allows one to choose cutoff values that balance false positive rate and the recovery of rare SNPs discardkeep
Genome-scale SNP mining projects Random, shotgun reads from whole-genome libraries aligned to the genome reference sequence Overlaps of large-insert clone sequences
SNP genotyping SNP discovery: which nucleotides in the genome are polymorphic? SNP genotyping: which alleles does an individual carry at a nucleotide locus that is known to be polymorphic? a g aacgtttatgtgatt|ccagtaaa|tacggca c t aacgtttatgtgattaccagtaaattacggca aacgtttatgtgattcccagtaaattacggca person 1. aacgtttatgtgattaccagtaaattacggca aacgtttatgtgattcccagtaaagtacggca person 2.
Genotyping by sequence heterozygous peak homoozygous peak
nucleotide diversity on human chromosomes Genome variation landscape “sparse” “dense” marker density “rare” “common” allele frequency