Surface Display Phage Bacteria Yeast Ribosome Displayed: passenger protein Anchoring motif: carrier protein.

Slides:

Advertisements

Similar presentations

Do Now:.  TRANSCRIPTION: process that makes an RNA copy of DNA.  RNA is single-stranded, and T is replaced by U (A-U; G-C)  RNA polymerase makes RNA,

Advertisements

Prof. Drs. Sutarno, MSc., PhD.. Biology is Study of Life Molecular Biology  Studying life at a molecular level Molecular Biology  modern Biology The.

TRANSLATION The process of converting the information stored in mRNA into a protein is called translation mRNA carries information from a gene to a structure.

Transcription & Translation Biology 6(C). Learning Objectives Describe how DNA is used to make protein Explain process of transcription Explain process.

8 The Molecular Genetics of Gene Expression. Fig. 8.6c Transcription Elongation.

Transcription and Translation

Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 3 Cell Structures and Their Functions Dividing Cells.

2.7 DNA Replication, transcription and translation

RNA and Protein Synthesis

13.3: RNA and Gene Expression

Protein Synthesis.

Gene expression.

An Overview of Protein Synthesis. Genes A sequence of nucleotides in DNA that performs a specific function such as coding for a particular protein.

How Genes Work. Transcription The information contained in DNA is stored in blocks called genes  the genes code for proteins  the proteins determine.

RNA carries DNA’s instructions.

Station 1 What is the purpose of genes? What is the purpose of RNA? In what 2 ways is RNA different from DNA?

Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.

FROM DNA TO PROTEIN Transcription – Translation We will use:

Chapter 4 Molecular Cloning Methods. Gene Cloning The Role of Restriction Endonuclease.

Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.

Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.

Regulation of Gene Expression Eukaryotes

VII RNA and Protein Synthesis

What is the job of p53? What does a cell need to build p53? Or any other protein?

CFE Higher Biology DNA and the Genome Translation.

Protein Synthesis 6C transcription & translation.

RNA and Protein Synthesis

12-3 RNA and Protein Synthesis

 Translation Creating Protein from mRNA Protein Structure  Proteins are made of Amino Acids.  There are 20 different Amino Acids.  The sequence of.

Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.

1 PROTEIN SYNTHESIS. DNA and Genes 2 Genes & Proteins DNA contains genes, sequences of nucleotide bases These genes code for polypeptides (proteins)

12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.

RNA AND PROTEIN SYNTHESIS

3.A.1 DNA and RNA Part IV: Translation DNA, and in some cases RNA, is the primary source of heritable information. DNA, and in some cases RNA, is the primary.

Molecular Genetics Protein Synthesis Overview. The Central Dogma DNA contains the blueprint for protein synthesis, but proteins are synthesized outside.

DNA in the Cell Stored in Number of Chromosomes (24 in Human Genome) Tightly coiled threads of DNA and Associated Proteins: Chromatin 3 billion bp in Human.

Copyright © by Holt, Rinehart and Winston. All rights reserved. ResourcesChapter menu Flow of Genetic Information The flow of genetic information can be.

Do Now: On the “Modeling DNA” handout, determine the complimentary DNA sequence and the mRNA sequence by using the sequence given.

Protein Synthesis- Transcription DNA-->RNA. Expression of Gene or Protein Synthesis I. Transcription A. Initiation B. Elongation C. Termination D. RNA.

Vigdis Lauvrak Bio H2003 Phage display.

You have been given a mission:  You must crack the code that you have been given. How many letters does it look like it requires to make just one English.

Ch 12-3 Notes, part 2 The Central Dogma = Protein Synthesis.

Chapter 13 – RNA & Protein Synthesis MS. LUACES HONORS BIOLOGY.

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

Protein Synthesis Chapter 9 p Protein Synthesis Gene- segment of DNA that codes for a protein. Gene Expression/ Protein Synthesis is the process.

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

DNA Transcription and Translation Review. There are 3 types of RNA: Messenger RNA (mRNA) Ribosomal RNA (rRNA) Transfer RNA (tRNA)

Chapter – 10 Part II Molecular Biology of the Gene - Genetic Transcription and Translation.

DNA to RNA to Protein. RNA Made up of 1. Phosphate 2. Ribose (a sugar) 3. Four bases RNA bases are: Adenine Guanine Cytosine Uracil (instead of thymine)

Lecture 8 A toolbox for mechanistic biologists (continued)

PROTEIN SYNTHESIS CHAPTER 10 section 4

Section 3: RNA and Gene Expression

Human Cells Gene Expression

13.3 RNA & Gene Expression I. An Overview of Gene _____________ A. RNA

RNA and Protein Synthesis

Transcription and Translation

Translation 2.7 & 7.3.

Transcription & Translation.

RNA: The other nucleic acid

Central Dogma Translation

From Genes to Proteins.

Protein Synthesis.

Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.

Protein Synthesis Translation

RNA and Protein Synthesis

From Genes to Proteins.

An Overview of Gene Expression

Transcription Protein Synthesis.

Presentation transcript:

Surface Display Phage Bacteria Yeast Ribosome Displayed: passenger protein Anchoring motif: carrier protein

Phage Display Panning

Filamentous phages are flexible rods about 1  m long and 6 nm in diameter, composed mainly (87% by mass) of a tube of helically arranged molecules of the 50-residue major coat protein pVIII22; there are 2700 copies in wild-type virions, encoded by a single phage gene VIII. Inside this tube lies the single-stranded viral DNA (ssDNA; nucleotides in wild-type strains). At one tip of the particle there are five copies each of the minor coat proteins pIII and pVI (genes III and VI, respectively); minor coat proteins pVII and pIX (genes VII and IX) are at the other tip.

Three rounds of panning against streptavidin at constant stringency (0.5% Tween)

His-Pro-Gln (HPQ) as a consensus binding motif specific for the biotin binding site of streptavidin

Epitope mapping of the anti-FLAG M2 monoclonal antibody. In order to determine which elements of the reported FLAG epitope sequence Asp-Tyr-Lys-Asp-Asp-Asp-Asp- Lys (DYKDDDDK) are required for antibody binding

Capture of the antibody by Protein A-agrose Protein A is a cell wall protein deriving from Staphylococcus aureus which exhibits unique binding properties for IgG from a variety of mammalian species and for some IgM and IgA as well. It binds with the Fc region of immunoglobulins through interaction with the heavy chain.

Epitope mapping of an anti-β-endorphin monoclonal antibody with the Ph.D.-12 library

Cell surface display Gram (-) cell

Ice nucleation factor promoting ice forming

Ice Nucleation Protein (INP) OmpC

Gram(+) cell Staphylococall Protein A

Yeast Surface Display

Screening Yeast Displayed Libraries

Phage vs Ribosome Display Phage display :(purple) ribosome display: (green)

Ribosome display The DNA library constructs contain all the signals required for cell-free in vitro transcription and translation. The absence of a stop codon at the end of the coding sequence prevents the release of the mRNA and the nascent polypeptide from the ribosomes. Low temperatures and an elevated level of magnesium ions further stabilize the ternary mRNA–ribosome– polypeptide complex. An unstructured tether is added to the C-terminus of the constructs to enable correct folding of the nascent polypeptides outside the ribosome tunnel. After selection, mRNA molecules are recovered by reverse transcription (RT) and amplified by polymerase chain reaction (PCR).