Restriction Endonucleases David Peterson. Structure of DNA and RNA.

Slides:



Advertisements
Similar presentations
Viruses: Morphology and Bacteriophage Life Cycle
Advertisements

Protein Shell DNA or RNA Membrane around virus Proteins that help virus get into proper host.
Bacterial viruses. Very complex shape, requiring 20 gene products for assembly - Capsid (head), contains linear dsDNA genome - Tail, consists of sheath.
Viruses (Ch. 18).
BIOCHEMISTRY SEMINAR FATHIMA I NAZEER February 13th 2004.
Introduction to Techniques
Gene structure DNA replication. Figure 7.4A Figure 7.5.
Viruses of Bacteria Chapter 13. General Characteristics of Viruses Non-living entities Not considered organisms Can infect organisms of every domain All.
 Non-living entities  Can infect organisms of every domain  Commonly referred to by organism they infect  Viruses that infect bacteria: Bacteriophage.
Unit Overview – pages Viruses, Bacteria, Protists, and Fungi Viruses and Bacteria Viruses.
Viruses, part 2.
Restriction Endonucleases
Bacteriophages ( a.k.a. Phages) Viruses that target bacteria Virus defining characteristics: parasitic entities Nucleic acid molecules protected by protein.
Types of cloning vectors
REPLICATION OF THE VIRUS
AP Biology Biotechnology today  Genetic Engineering  manipulation of DNA  if you are going to engineer DNA & genes & organisms, then you need.
Quickie Intro to DNA Technologies
The Genetics of Viruses and Bacteria
DNA Cloning and PCR.
Part 1: Basic Biotechnology TACGCACATTTACGTACGCGGATGCCGCGACT ATGATCACATAGACATGCTGTCAGCTCTAGTAG ACTAGCTGACTCGACTAGCATGATCGATCAGC TACATGCTAGCACACYCGTACATCGATCCTGA.
VIRUSES.
AP Biology Discussion Notes Wednesday 01/14/2015.
Viruses. Nonliving particles Very small (1/2 to 1/100 of a bacterial cell) Do not perform respiration, grow, or develop Are able to replicate (only with.
 They are reproduce  Carry on the metabolism  Organize the cell  They contain enzymes, nucleic acids, carbohydrates, lipids  Adapt to changing environments.
Viruses. Relative sizes  Viruses are one of the smallest biological structures known  Between 20 and 50 nanometers in size.  The average animal cell.
Viruses SBI 3C – Grade 11 College Biology. Bacteria vs. Viruses Let’s investigate! E. coli O157:H7.
Bacteriophage Families with a detailed description of Models Phages Myoviridae – Mu Viro102: Bacteriophages & Phage Therapy 3 Credit hours NUST Centre.
Fig µm Chapter 19. Fig RESULTS 12 3 Extracted sap from tobacco plant with tobacco mosaic disease Passed sap through a porcelain filter.
Restriction Enzymes Gabriela Perales 1. Restriction Enzymes  Restriction enzymes, also called restriction endonucleases, are molecules that cut double.
Viruses. Nonliving particles Very small (1/2 to 1/100 of a bacterial cell) Do not perform respiration, grow, or develop Are able to replicate (only with.
Restriction Enzymes Biotechnology Fall 2013.
Viruses Chapter What is a virus? Viruses- microscopic particles that invade cells and destroy them. A virus is NOT a cell. Has genetic material.
AP Biology Discussion Notes Thursday 1/28/2016. Goals for Today Be able to describe how bacteria increase their genetic variation Be able to describe.
Page: Genial - Restriction Enzymes and Site-Specific DNA Cleavage Procedures for chemical isolation of DNA usually lead to random breakage of double-stranded.
Fig µm Chapter 19 - Viruses. Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings Overview: A Borrowed Life Viruses.
Chapter 19.  Non-living ◦ Non-cellular ◦ Cannot grow or reproduce on its own ◦ No metabolism  Cause disease ◦ AIDS, colds, flu, measles, mono  Cause.
Viral Replication EK 3C3: Viral replication results in genetic variation and viral infection can introduce genetic variation into the hosts.
T Even T Odd Bacteriophage
MICROBIOLOGIA GENERALE Viruses of prokaryotes. The main types of bacterial viruses.
Major Parts of a Virus - Bacteriophage
AP Biology What do you notice about these phrases? radar racecar Madam I’m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was.
Biotechnology Part 1 Genetics of Viruses
An Introduction to the Viruses Non-Living Etiologies
Viruses.
SBI 3U Ms.Zafar October 1st, 2012
Fig Figure 19.1 Are the tiny viruses infecting this E. coli cell alive? 0.5 µm.
RESTRICTION ENZYMES.
Headings Vocab Important Info
Chapter 20~ DNA Technology & Genomics
Chapter 20~ DNA Technology & Genomics
Chapter 13~ DNA Technology & Genomics
Viruses.
Standard SB3d: Compare and contrast viruses with living organisms.
Viruses.
Gene structure DNA replication
Turner College & Career High School  2016
Viruses.
Bacteria Bacteria review one-celled prokaryotes reproduce by mitosis
Virus Basics.
Chapter 15 Viruses, Viral Life Cycles, Retroviruses.
Viruses Chapter 19.
Viruses.
Biotechnology Part 1 Genetics of Viruses
RESTRICTION ENZYMES BY NIKAM C.D. ASSISTANT PROFESSOR,
Fig Chapter 19: VIRUS Figure 19.1 Are the tiny viruses infecting this E. coli cell alive? 0.5 µm.
What is it? By Sandy Decker
Biotechnology Part 1 Genetics of Viruses
Viruses.
Restriction Enzyme Digestion of DNA
Viruses.
Presentation transcript:

Restriction Endonucleases David Peterson

Structure of DNA and RNA

DNA RNA Protein Information Flow in Cells

DNA is a Double Helix

Phage 48,512 bp dsDNA virus that grows on E. coli. Life cycle ~ 30 min at 37°C typical burst ~ particles

Bacteriophage infection: 1 → 300 → 10,000 → 3,000,000 → 10 9 ! 30’ 30’ 30’ 30’ Bacterium Phage DNA Typical phage infection cycle: 1. Phage DNA penetrates bacterial envelope 2. Bacterial DNA is disrupted & phage DNA is replicated 3. Phage structural proteins are synthesized 4. Heads, tails, fibers made and assembled into particles 5. Cell lysis, release of ~ 100 – 300 phage particles 30 min

1000’s of phage particles attacking an E. coli cell

Bacteriophages Make Plaques

Restriction Endonucleases Type 1 Cuts at random position relative to recognition sequence (sometimes far away) Type II Cuts at recognition sequence Type III Cuts at fixed distance from recognition sequence

SV40 DNA Cut with Hin cII

Palindromes Madam, I’m Adam. Gary knits a stinky rag. Harass sensuousness, Sarah. Go hang a salami, I’m a lasagna hog.

Most Restriction Enzymes Recognize Palindromes GATATC ||||||||||||||||||| CTATAG 5’ 3’

EcoRV Bound to DNA 1AZ0

Methylation sites

Most Restriction Enzymes Recognize Palindromes GATATC ||||||||||||||||||| CTATAG 5’ 3’

EcoRV Bound to DNA 1AZ0

SV40 DNA Cut with Hin cII

Restriction Enzymes Aid in DNA Cloning

Dan Nathans and Hamilton Smith Werner Arber Nobel Prize in Physiology or Medicine 1978