Genome Assembly Bonnie Hurwitz Graduate student TMPL.

Slides:

Advertisements

Similar presentations

Celera Assembler Arthur L. Delcher Senior Research Scientist CBCB University of Maryland.

Advertisements

Sequencing a genome. Definition Determining the identity and order of nucleotides in the genetic material – usually DNA, sometimes RNA, of an organism.

Tucson High School Biotechnology Course Spring 2010.

Lecture 14 Genome sequencing projects

DNA Sequencing Lecture 9, Tuesday April 29, 2003.

Genome Sequence Assembly: Algorithms and Issues Fiona Wong Jan. 22, 2003 ECS 289A.

Some new sequencing technologies. Molecular Inversion Probes.

DNA Sequencing – “Plus and Minus” Plus –Incubate with T4 DNA Polymerase and single dNTP –T4 Polymerase degrades 3’ ends in absence of dNTP –Fractionated.

Elephant Seg Dup Analysis 1.Genome 2.Parameters for Pipeline 3.Analysis.

Class 02: Whole genome sequencing. The seminal papers ``Is Whole Genome Sequencing Feasible?'' ``Whole-Genome DNA.

DNA Sequencing. The Walking Method 1.Build a very redundant library of BACs with sequenced clone- ends (cheap to build) 2.Sequence some “seed” clones.

Stuff to Do. Midterm I questions due 1/31 me your question (with answers), –if you have the capability, mail complete questions, figures, etc. and.

Sequencing Informatics Gabor T. Marth Department of Biology, Boston College BI420 – Introduction to Bioinformatics.

2: Large-Scale 1 / 42 1 Large!. 2: Large-Scale 2 / 42 High throughput technologies: Sequencing Gene expression profiling Chip-CHIP and tiling arrays Whole.

Novel multi-platform next generation assembly methods for mammalian genomes The Baylor College of Medicine, Australian Government and University of Connecticut.

Zebra Finch Seg Dup Analysis 1.Genome 2.Parameters for Pipeline 3.Analysis.

Sequencing Informatics Gabor T. Marth Department of Biology, Boston College BI420 – Introduction to Bioinformatics.

CS273a Lecture 4, Autumn 08, Batzoglou Hierarchical Sequencing.

CSE182-L10 LW statistics/Assembly. Whole Genome Shotgun Break up the entire genome into pieces Sequence ends, and assemble using a computer LW statistics.

Evaluation of PacBio sequencing to improve the sunflower genome assembly Stéphane Muños & Jérôme Gouzy Presented by Nicolas Langlade Sunflower Genome Consortium.

Reminder: Class on Friday, Discussion of Li et al. Proposal/Projects CAMERA feedback?

Genome sequencing. Vocabulary Bac: Bacterial Artificial Chromosome: cloning vector for yeast Pac, cosmid, fosmid, plasmid: cloning vectors for E. coli.

Last lecture summary. recombinant DNA technology DNA polymerase (copy DNA), restriction endonucleases (cut DNA), ligases (join DNA) DNA cloning – vector.

De-novo Assembly Day 4.

How to Build a Horse Megan Smedinghoff.

CS 394C March 19, 2012 Tandy Warnow.

Bacterial Genome Assembly C. Victor Jongeneel Bacterial Genome Assembly | C. Victor Jongeneel | PowerPoint by Casey Hanson.

The New Zealand Institute for Plant & Food Research Limited Potato Genome Sequencing Consortium, notes from the edge Dr Susan Thomson, Dr Mark Fiers, Dr.

Next generation sequence data and de novo assembly For human genetics By Jaap van der Heijden.

Sequence assembly using paired- end short tags Pramila Ariyaratne Genome Institute of Singapore SOC-FOS-SICS Joint Workshop on Computational Analysis of.

Genome sequencing Haixu Tang School of Informatics.

Bioinformatics and Sequencing Relevant to SolCAP

Steps in a genome sequencing project Funding and sequencing strategy source of funding identified / community drive development of sequencing strategy.

P. Tang ( 鄧致剛 ); RRC. Gan ( 甘瑞麒 ); PJ Huang ( 黄栢榕 ) Bioinformatics Center, Chang Gung University. Genome Sequencing Genome Resequencing De novo Genome.

Genome sequencing Haixu Tang School of Informatics.

Biological Motivation for Fragment Assembly Rhys Price Jones Anne R. Haake.

Fuzzypath – Algorithms, Applications and Future Developments

A Sequenciação em Análises Clínicas Polymerase Chain Reaction.

SIZE SELECT SHEAR Shotgun DNA Sequencing (Technology) DNA target sample LIGATE & CLONE Vector End Reads (Mates) SEQUENCE Primer.

The Changing Face of Sequencing

FuzzyPath Assemblies - from Mixed Solexa/454 Datasets to Extremely GC Biased Genomes Zemin Ning The Wellcome Trust Sanger Institute.

Stratton Nature 45: 719, 2009 Evolution of DNA sequencing technologies to present day DNA SEQUENCING & ASSEMBLY.

Problems of Genome Assembly James Yorke and Aleksey Zimin University of Maryland, College Park 1.

Assembly of Paired-end Solexa Reads by Kmer Extension using Base Qualities Zemin Ning The Wellcome Trust Sanger Institute.

The Genome Assemblies of Tasmanian Devil Zemin Ning The Wellcome Trust Sanger Institute.

FuzzyPath - A Hybrid De novo Assembler using Solexa and 454 Short Reads Zemin Ning The Wellcome Trust Sanger Institute.

De Novo Genome Assembly - Introduction

The Wellcome Trust Sanger Institute

Mojavensis: Issues of Polymorphisms Chris Shaffer GEP 2009 Washington University.

Whole Genome Sequencing (Lecture for CS498-CXZ Algorithms in Bioinformatics) Sept. 13, 2005 ChengXiang Zhai Department of Computer Science University of.

COMPUTATIONAL GENOMICS GENOME ASSEMBLY

Accessing and visualizing genomics data

Chapter 5 Sequence Assembly: Assembling the Human Genome.

454 Genome Sequence Assembly and Analysis HC70AL S Brandon Le & Min Chen.

Cross_genome: Assembly Scaffolding using Cross-species Synteny Zemin Ning High Performance Assembly.

Meet the ants Camponotus floridanus Carpenter ant Harpegnathos saltator Jumping ant Solenopsis invicta Red imported fire ant Pogonomyrmex barbatus Harvester.

Phusion2 Assemblies and Indel Confirmation Zemin Ning The Wellcome Trust Sanger Institute.

Bacterial Genome Assembly Tutorial: C. Victor Jongeneel Bacterial Genome Assembly v9 | C. Victor Jongeneel1 Powerpoint: Casey Hanson.

Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es.

Cross_genome: Assembly Scaffolding using Cross-species Synteny

Jeong-Hyeon Choi, Sun Kim, Haixu Tang, Justen Andrews, Don G. Gilbert

Genome sequence assembly

Pre-genomic era: finding your own clones

CS 598AGB Genome Assembly Tandy Warnow.

Bioinformatics: Buzzword or Discipline (???)

CSCI 1810 Computational Molecular Biology 2018

Sequence the 3 billion base pairs of human

AMOS Assembly Validation and Visualization

Presentation transcript:

Genome Assembly Bonnie Hurwitz Graduate student TMPL

Genome assembly

…ACGGCTGCGTTACATCGATCAT ACATCGATCATTTACGATACCATTG… sheared clone library (insert sizes of 1-2, 3- 4, 30-40, 100kb) end sequence clones (f / r) assemble reads by alignment identity genomic DNA Shotgun sequencing (WGS)

break A B C D E F G H ABCDFG H E’E’’ mate pair linkage contig “composite” genome scaffold Genome scaffolding

0.57 ¢ 0.19 ¢ 0.35 ¢ Sequence production (Billions of bases/month) Cost: Cents per base ¢ ¢ Sanger sequencing costs 2008 ~ $1/read

454 Pyrosequencing - the generations Stats/ runGS20FLXTitanium Total sequence (Mb)401001,000 Read length (bp)100>200>400 # reads400,000 1M Paired Ends?NOY, 50% 0.03 ¢ 0.01 ¢ ¢ (Sanger is currently 0.1 ¢ ) Cost / bp -->

When is a genome “finished”? (by Poisson Calculations) Fold coverage Percent of genome sequenced 0.25 x22% 0.50 x39% 0.75 x53% 1 x63% 2 x88% 3 x95% 4 x98% 5 x99.4% 6 x99.75% 7 x99.91% 8 x99.97% 9 x99.99% 10 x99.995% Coverage: Coverage is the average number of reads representing a given nucleotidenucleotide in the reconstructed sequence. It can be calculated from the length of the original genome (G), the number of reads (N), and the average read length(L) as NL / G

Tablet: Assembly Viewer Sequence Overlap Consensus Sequence reads Contig info Current location

Our goal today Assemble a phage genome – Assemble a phage genome with different levels of coverage – Compute basic statistics on each genome assembly – View the assemblies – Compare the best assembly to the finished genome