PROTEIN SYNTHESIS Higher Level

Learning Outcomes At the end of this topic you should be able to 1. Outline the steps in protein synthesis 2.Know that DNA contains the code for protein 3.Know that enzymes unwind the DNA 4.Know this code is transcribed to mRNA 5.Know the role of RNA polymerase 6.Know the role of a codon

Learning Outcomes(cont.) At the end of this topics you should be able to 7.Know the code is translated on the ribosome 8.Know the ribosome is composed of subunits 9. Describe how amino acids are assembled in the correct order determined by the codons on mRNA to synthesise the protein 10. Know that a stop codon on mRNA signals the release of the protein

Lesson Objectives (cont.) At the end of this lesson you should be able to 11. Know that the protein folds into its functional shape 12. Give the location of protein synthesis 13. Understand the molecular involvement of DNA, mRNA, tRNA, rRNA and amino acids in the process of protein synthesis

For Protein Synthesis You need: 1. A supply of amino acids – cytoplasm 2. Instructions as how to join the amino acids together – genetic code 3.An assembly line – ribosomes 4.A messenger to carry information from DNA to ribosomes

Protein Synthesis - Steps 3 stages 3 stages: 1.Transcription 2.Translation Remember:DNA  RNA  ProteinRemember:DNA  RNA  Protein

RNA is composed of 3 parts 1.Ribose: smaller sugar than deoxyribose of DNA 2.Phosphate 3.4 Nitrogenous Bases A,G,U,C RNA is single stranded and thus smaller & able to leave the nucleus of the cell

DNA  RNA  Protein Nuclear membrane Transcription RNA Processing Translation DNA mRNA Ribosome Protein Eukaryotic Cell TranscriptionTranslation

Transcription Translation DNA mRNA Ribosome Protein Prokaryotic Cell – No nucleus DNA  RNA  Protein

Learning Check What is RNA composed of? RNA(ribonucleic acid) DNA (deoxyribonucleic acid)How does RNA (ribonucleic acid) differ from DNA (deoxyribonucleic acid)? What are the three stages in Protein synthesis?

1. Transcription Nuclear membrane Transcription RNA Processing Translation DNA mRNA Ribosome Protein Eukaryotic Cell

1. Transcription nucleus DNARNAThe transfer of information in the nucleus from a DNA molecule to an RNA molecule. 1 DNAtemplateOnly 1 DNA strand serves as the template mRNAWhen complete, mRNA molecule is released into the cytoplasm

Video Clip available in extra material folder

Transcription Takes places in the nucleus of the cell The process by which the information from DNA is transferred to RNA. DNA uncoils and unzips. The exposed DNA bases are matched up with RNA bases in the nucleus to form mRNA.

1. Transcription DNAmRNA RNA Polymerase Enzyme

A U G G G C U U A A A G C A G U G C A C G U U This is a molecule of messenger RNA. It was made in the nucleus by transcription from a DNA molecule. mRNA molecule codon

Learning Check What type of RNA molecule is responsible for taking the DNA copy from the nucleus into the cytoplasm What parts of the cell do you find RNA in? Can you outline the stages in transcription?

mRNA Takes place in the nucleus of the cell The process by which the information from DNA is transferred to RNA. DNA uncoils and unzips. The exposed DNA bases are matched up with RNA bases in the nucleus to form mRNA.

Types of RNA Three types ofRNAThree types of RNA: A.messenger RNA (mRNA) B.transfer RNA (tRNA) C.ribosomal RNA (rRNA) Remember: all produced in the nucleus!Remember: all produced in the nucleus!

A. Messenger RNA (mRNA) proteinCarries the information for a specific protein. nucleotidesMade up of 500 to 1000 nucleotides long. codonsMade up of codons (sequence of three bases) codonamino acidEach codon is specific for one amino acid.

A. Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1

B. Transfer RNA (tRNA) Made up of 75 to 80 nucleotides long. amino acidPicks up the appropriate amino acid floating in the cytoplasm amino acids mRNATransports amino acids to the mRNA. anticodons mRNAcodonsHas anticodons that are complementary to mRNA codons. codons mRNARecognizes the appropriate codons on the mRNA and bonds to them with H-bonds.

C. Ribosomal RNA (rRNA) rRNAMade up of rRNA is 100 to 3000 nucleotides long. ribosome.Important structural component of a ribosome. proteins ribosomes.Associates with proteins to form ribosomes.

Ribosomes Large and small subunits.Large and small subunits. rRNA (40%) proteins (60%).Composed of rRNA (40%) and proteins (60%). mRNAtRNA.Both units come together and help bind the mRNA and tRNA.

Ribosomes Large subunit Small subunitmRNA AUGCUACUUCG

Learning Check What are the three types of RNA? Where is each type produced? What is the function of each type of RNA?

3. Translation Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

3. Translation proteinscytoplasmSynthesis of proteins in the cytoplasm Involves the following:Involves the following: mRNA (codons) 1.mRNA (codons) tRNA (anticodons) 2.tRNA (anticodons) rRNA 3.rRNA ribosomes 4.ribosomes amino acids 5.amino acids

Translation In the cytoplasm, translation occurs. The mRNA binds to a ribosome. The strand of mRNA is pulled through the ribosome three bases at a time, in triplets. Each of these triplets on the mRNA strand is called a codon.

A U G G G C U U A A A G C A G U G C A C G U U This is a molecule of messenger RNA. It was made in the nucleus by transcription from a DNA molecule. mRNA molecule codon

A U G G G C U U A A A G C A G U G C A C G U U A ribosome on the rough endoplasmic reticulum attaches to the mRNA molecule. ribosome

It brings an amino acid to the first three bases (codon) on the mRNA. A U G G G C U U A A A G C A G U G C A C G U U Amino acid tRNA molecule anticodon U A C A transfer RNA molecule arrives. The three unpaired bases (anticodon) on the tRNA link up with the codon.

A U G G G C U U A A A G C A G U G C A C G U U Another tRNA molecule comes into place, bringing a second amino acid. U A C C C G Its anticodon links up with the second codon on the mRNA.

A U G G G C U U A A A G C A G U G C A C G U U Another tRNA molecule brings the next amino acid into place. C C G A A U

A U G G G C U U A A A G C A G U G C A C G U U A peptide bond joins the second and third amino acids to form a polypeptide chain. C C G

The polypeptide chain gets longer. A U G G G C U U A A A G C A G U G C A C G U U G U C A C G The process continues. This continues until a termination (stop) codon is reached. The polypeptide is then complete.

tRNA Transfer RNA (tRNA), reads the strand of mRNA and translates it into a strand of amino acids. A molecule of tRNA has at one end a set of three bases that will complement the mRNA strand; this is called the anticodon.

tRNA If the 3 base anticodon of the tRNA complements the 3 base codon of the mRNA, they briefly combine. The amino acid is left behind when the tRNA leaves. As each codon is read, the next tRNA brings in a new amino acid and the polypeptide (protein) chain grows. This requires enzymes and ATP.

End Product primary structure of a proteinThe end products of protein synthesis is a primary structure of a protein. amino acid peptide bondsA sequence of amino acid bonded together by peptide bonds. aa1 aa2 aa3 aa4 aa5 aa200 aa199

Functional Protein The protein now has to undergo folding and the addition of bonds Folding allows the Protein to reach its 3D (Tertiary Shape) which influences its Function.

Learning Check The anticodon UAC belongs to a tRNA that recognizes and binds to a particular amino acid. What would be the DNA base code for this amino acid?

Answer: tRNA - UAC (anticodon)tRNA - UAC (anticodon) mRNA- AUG (codon)mRNA- AUG (codon) DNA - TACDNA - TAC

What have you learned? Can you ……………… 1. Outline the steps in protein synthesis 2.Understand that a strand of DNA is copied by transcription 3.Understand the role of mRNA 4.Know the function of a ribosome in protein synthesis 5.Understand the process of translation that leads to the formation of a new protein 6.Know that the shape of a protein determines its function

End