Chapter 8 Sandra Loranger Stacie Daer Mike Reilly.

Slides:

Advertisements

Similar presentations

Transcription and Translation

Advertisements

3 Types of RNA.

RNA and Protein Synthesis

Review: The flow of genetic information in the cell is DNA  RNA  protein  The sequence of codons in DNA spells out the primary structure of a polypeptide.

TRANSLATION The process of converting the information stored in mRNA into a protein is called translation mRNA carries information from a gene to a structure.

Protein Synthesis Ordinary Level. Lesson Objectives At the end of this lesson you should be able to 1.Outline the steps in protein synthesis 2.Understand.

2.7 DNA Replication, transcription and translation

RNA and Protein Synthesis

13.3: RNA and Gene Expression

10-2: RNA and 10-3: Protein Synthesis

 Assemble the DNA  Follow base pair rules  Blue—Guanine  Red—Cytosine  Purple—Thymine  Green--Adenine.

The Structure of RNA RiboNucleic Acid

How Genes Work. Transcription The information contained in DNA is stored in blocks called genes  the genes code for proteins  the proteins determine.

Microbial Genetics: DNA and RNA What chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used.

Gene to Protein Part 2: Translation After the mRNA transcript leaves the nucleus it goes to a ribosome (site of protein synthesis).

RNA carries DNA’s instructions.

Trait Chapter 12 Section 3. Ribonucleic acid Responsible for the movement of genetic information from the DNA in the nucleus to the site of protein.

Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis

Copyright © John Wiley & Sons, Inc. All rights reserved.  When DNA is transcribed, the result is an RNA molecule.  RNA is then translated into a sequence.

Biology 10.1 How Proteins are Made:

Gene Expression and Control

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

13.2 Ribosomes and Protein Synthesis

Chapter 13: RNA and Protein Synthesis

Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis

The Genetic Code.

DNA, RNA and Protein Synthesis. In eukaryotes, genetic information is stored in which organelle? nucleus.

Central Dogma DNA  RNA  Protein. …..Which leads to  Traits.

RNA and Protein Synthesis

12-3 RNA and Protein Synthesis

Protein Synthesis How’d you do? Nucleus Part of the cell containing DNA and RNA and responsible for growth and reproduction. In eukaryotic cells, the.

 DNA is the blueprint for life – it contains your genetic information  The order of the bases in a segment of DNA (GENE) codes for a particular protein;

12.3 DNA, RNA, and Protein Objective: 6(C) Explain the purpose and process of transcription and translation using models of DNA and RNA.

12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.

Chapter 8 Section 8.5: Translation 1. Objectives SWBAT describe how mRNA codons are translated into amino acids. SWBAT summarize the process of protein.

 Watch these 2 animations and try to explain what is going on.  Animation 1 Animation 1  Animation 2 Animation 2.

Core Transcription and Translation

The student is expected to: 4B investigate and explain cellular processes, including homeostasis, energy conversions, transport of molecules, and synthesis.

PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.

Protein Synthesis The process of protein synthesis is explained by the central dogma of molecular biology, which states that: DNA  RNA  Proteins How.

Protein Synthesis. Review…  DNA:  Found in the nucleus  Double stranded  Contains the instructions for controlling the cell (including instructions.

Ribosomes and Protein Synthesis. Learning Objectives  Identify the genetic code and explain how it is read.  Summarize the process of translation. 

The Central Dogma of Molecular Biology DNA  RNA  Protein  Trait.

8.4 Transcription KEY CONCEPT Transcription converts a gene into a single-stranded RNA molecule.

RNA and Protein Synthesis Chapter How are proteins made? In molecular terms, genes are coded DNA instructions that control the production of.

Part 5 Translation Translation: mRNA and the Genetic Code Triplet code- codon 3 sequential Nitrogen bases in mRNA 64 different mRNA codons.

Translation Notes 4a. The general pathway by which ribosomes synthesize proteins, using tRNAs to translate genetic information in mRNA.

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

CHAPTER 10 “HOW PROTEINS ARE MADE”. Learning Targets  I will compare the structure of RNA with that of DNA.  I will summarize the process of transcription.

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

DNA Transcription and Translation Review. There are 3 types of RNA: Messenger RNA (mRNA) Ribosomal RNA (rRNA) Transfer RNA (tRNA)

Chapter – 10 Part II Molecular Biology of the Gene - Genetic Transcription and Translation.

Notes: Transcription DNA vs. RNA

How to Make a Protein?.

RNA & Protein Synthesis

Protein Synthesis Standards:

RNA and Protein Synthesis

12-3 RNA and Protein Synthesis

Protein Synthesis Step 2: Translation

RNA and Protein Synthesis

From Genes to Proteins.

Protein Synthesis Miss Richardson SBI4U.

Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.

How genes on a chromosome determine what proteins to make

Transcription/ Translation Notes 16-17

From Genes to Proteins.

RNA, Ribosomes, And Protein synthesis

An Overview of Gene Expression

The Production of Proteins by DNA

Presentation transcript:

Chapter 8 Sandra Loranger Stacie Daer Mike Reilly

Question: Distinguish between mRNA, rRNA, and tRNA. What molecule does each abbreviation represent and what role does each molecule play in the process of gene expression? Describe and explain.

RNA’s  mRNA – messenger RNA  tRNA – transfer RNA  rRNA – Ribosomal RNA

htttp:// mRNA - encodes proteins Messenger Ribonucleic Acid (mRNA) is a copy of the information carried by a gene. mRNA is transcribed from a DNA template, and carries information to the sites of protein synthesis: the ribosome.

The "life cycle" of an mRNA in a eukaryotic cell

Ribosomal RNA (rRNA) is the central component of the ribosome's protein manufacturing machinery. rRNA are sub cellular structures that are composed of another kind of RNA. Each ribosome is composed of 2 subunits 1 large and 1 small when assembled it can bind to structures called Transfer RNA (tRNA) carrying amino acids. Work Cited: Biology science for life.

Transfer RNA (tRNA) tRNA - adaptor, binds amino acids and rRNA and translates between mRNA and protein. Each tRNA also carries the amino acid corresponding to the mRNA codon to which it binds. Transfer RNA translates the language of nucleotides into the language of amino acids.

 tRNAs bring amino acids to the ribosomes during translation to be assembled into polypeptide chains.  tRNAs are encoded by tRNA genes. All tRNA molecules are similar in size and shape. All tRNAs have CCA at the 3' end to which the amino acid attaches. At the other "end" of the tRNA molecule is the anticodon, which, during translation, "reads" the matching codon on the mRNA.