Slide 1 of 39 Copyright Pearson Prentice Hall 12-3 RNA and Protein Synthesis 12–3 RNA and Protein Synthesis

Slide 2 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis DNA is located in the nucleus. DNA is impermeable to the nuclear envelope. Genes are segments of DNA which code for the production of proteins. Ribosomes outside the nucleus make the proteins. RNA contains coded information for making proteins.

12–3 RNA and Protein Synthesis Slide 3 of 39 Copyright Pearson Prentice Hall Do you see a problem with this scenario?

12–3 RNA and Protein Synthesis Slide 4 of 39 Copyright Pearson Prentice Hall RNA is the solution to this problem. RNA is DNA’s main man. RNA is DNA’s “go to guy”. RNA is DNA’s number one “get it done person”. One of RNA’s jobs is to copy DNA’s instructions and take those instructions out of the nucleus to the ribosomes.

12–3 RNA and Protein Synthesis Slide 5 of 39 Copyright Pearson Prentice Hall The Structure of RNA 1. RNA is a type of nucleic acid which is made up of a long chain of nucleotides. 2. Each nucleotide, like DNA, is made up of a: 1. 5-carbon sugar, 2. phosphate group 3. nitrogenous base. (Sounds familiar just like DNA’s nucleotides)

12–3 RNA and Protein Synthesis Slide 6 of 39 Copyright Pearson Prentice Hall The Structure of RNA There are three main differences between RNA and DNA: 1. The sugar in RNA is ribose instead of deoxyribose. 2. RNA is a single-strand of nucleotides. 3. RNA contains uracil in place of thymine.

Slide 7 of 39 Copyright Pearson Prentice Hall Types of RNA There are three types of RNA 1. messenger RNA ~ mRNA 2. ribosomal RNA ~ rRNA 3. transfer RNA ~ tRNA

12–3 RNA and Protein Synthesis Slide 8 of 39 Copyright Pearson Prentice Hall Types of RNA Messenger RNA (mRNA) copies DNA’s code for making proteins and takes it’s copy to the ribosomes.

12–3 RNA and Protein Synthesis Slide 9 of 39 Copyright Pearson Prentice Hall Types of RNA Ribosomal RNA (rRNA) is the main component of a ribosome. rRNA is bound into two “round” units by proteins to form the large and small subunits which make up a ribosome. Ribosome Ribosomal RNA

12–3 RNA and Protein Synthesis Slide 10 of 39 Copyright Pearson Prentice Hall Types of RNA Transfer RNA (tRNA) transfers specific amino acids to the ribosome for the making of the proteins. Amino acid Transfer RNA

12–3 RNA and Protein Synthesis Slide 11 of 39 Copyright Pearson Prentice Hall Transcription What is transcription?

12–3 RNA and Protein Synthesis Slide 12 of 39 Copyright Pearson Prentice Hall Transcription RNA copies DNA’s code in its own language and take the code to the ribosomes to make proteins. Transcription requires the enzyme RNA polymerase.

Slide 13 of 39 Copyright Pearson Prentice Hall 1.During transcription, RNA polymerase attaches to DNA and separates the DNA strands. Steps to Transcription:

Slide 14 of 39 Copyright Pearson Prentice Hall 2. RNA polymerase then adds RNA nucleotides to one side of the DNA molecule/the sense side of DNA. -DNA is a double strand of nucleotides BUT only one side of the DNA molecule actually codes for making proteins.

12–3 RNA and Protein Synthesis Slide 15 of 39 Copyright Pearson Prentice Hall 2 strands of DNA 1.Sense side: Has code for making proteins. 2.Antisense side: Has no code~ makes no sense.

Slide 16 of 39 Copyright Pearson Prentice Hall 3. RNA nucleotides are added to the sense side of DNA following the base pair rule: Guinine bonds to Cytosine and Uracil bonds to Adenine A T G G C G C A C T Sense side of DNA U A C C G

12–3 RNA and Protein Synthesis Slide 17 of 39 Copyright Pearson Prentice Hall 4. This single strand of RNA is now known as messenger RNA or mRNA and it now has a copy of DNA’s code for making proteins.

Slide 18 of 39 Copyright Pearson Prentice Hall 5. Since mRNA is single stranded it can now take a copy of DNA’s code out of the nucleus to the ribosomes.

12–3 RNA and Protein Synthesis Slide 19 of 39 Copyright Pearson Prentice Hall Transcription RNA RNA polymerase DNA Hyperlink

12–3 RNA and Protein Synthesis Slide 20 of 39 Copyright Pearson Prentice Hall The Genetic Code Protein Synthesis: The process of using mRNA’s copy of DNA’s code to make all necessary proteins. Takes place where? -at the ribosomes

Slide 21 of 39 Copyright Pearson Prentice Hall Proteins are made up of: -long chains of amino acids Total number of different amino acids that make up all proteins: -20

Slide 22 of 39 Copyright Pearson Prentice Hall These 20 different amino acids bond in various orders (like the letters of the alphabet) to create all proteins.

12–3 RNA and Protein Synthesis Slide 23 of 39 Copyright Pearson Prentice Hall The Genetic Code A codon consists of three RNA nucleotides in a row on mRNA that code for a particular amino acid.

Slide 24 of 39 Copyright Pearson Prentice Hall

Slide 25 of 39 Copyright Pearson Prentice Hall Start codon: Three nitrogen bases in a row on mRNA that starts EVERY protein…..AUG Amino acid Methionine starts every protein

Slide 26 of 39 Copyright Pearson Prentice Hall Stop codon: Three nitrogen bases in a row on mRNA that ends every protein. Three different codons: UAA, UAG, UGA Stop codon do not code for any amino acid

12–3 RNA and Protein Synthesis Slide 27 of 39 Copyright Pearson Prentice Hall Translation What is translation?

Slide 28 of 39 Copyright Pearson Prentice Hall Translation Translation: -Process by which the ribosome reads mRNA’s code and makes a protein.

Slide 29 of 39 Copyright Pearson Prentice Hall Translation Steps of translation: 1. mRNA leaves the nucleus and take its code to the ribosomes. Nucleus mRNA

Slide 30 of 39 Copyright Pearson Prentice Hall 2. Ribosome attaches to mRNA and moves along it looking for a start codon/AUG. 3. Transfer RNA/tRNA travels through the cytoplasm locating the appropriate amino acid.

Slide 31 of 39 Copyright Pearson Prentice Hall Anticodon: anti = opposite An anticodon is three nitrogen bases on the end of tRNA. Its code is opposite of mRNA’s codon.

12–3 RNA and Protein Synthesis Slide 32 of 39 Copyright Pearson Prentice Hall Translation Lysine tRNA Phenylalanine Methionine Ribosome mRNA Start codon 4. As the ribosome reads one codon at a time, tRNA brings down the appropriate amino acid.

12–3 RNA and Protein Synthesis Slide 33 of 39 Copyright Pearson Prentice Hall Translation 5. Amino acids bind together with peptide bonds forming a long chain. tRNA Ribosome mRNA Lysine Translation direction

Slide 34 of 39 Copyright Pearson Prentice Hall Translation 6.After a tRNA delivers its amino acid, it breaks away and goes out to find a new amino acid. 7.The process continues until the ribosome reads a stop codon. Polypeptide Ribosome tRNA mRNA

Slide 35 of 39 Copyright Pearson Prentice Hall 8.The long chain of amino acids -now a polypeptide/protein -breaks away and goes where? -to the golgi -Why to the golgi? -to be processes and to be given its 3-D shape

Slide 36 of 39 Copyright Pearson Prentice Hall The sequence of bases in DNA is used as a template for mRNA. The codons of mRNA specify the sequence of amino acids in a protein. Codon mRNA Alanine Arginine Leucine Amino acids within a polypeptide Single strand of DNA Review:

Slide 37 of 39 Copyright Pearson Prentice Hall HyperlinkHyperlink of translation

Slide 38 of 39 Copyright Pearson Prentice Hall Sense Strand of DNA: CCAGTATACCCGAGTACCCCGCAGGAGCACCAGGAATTCCGCCATACACGCCCATCCCCACTCGAAAAAAAAAA TATA Box Poly-a-tail Promoter Region Termination Region Site where transcription begins Site where transcription ends. Start of a gene End of gene Primary mRNA: IntronExon Intron Exon Intron I I I I I I AUAUGGGCUCAUGGGGCGUCCUCGUGGUCCUUAAGGCGGUAUGUGCGGGUAGGGGUGAGCUUUUUUUUUU Start codon Stop codon Start codon Stop codon Tells ribosome toTells ribosome to start making protein stop making protein Mature mRNA: Exon Exon I I I AUGGGGCGUCCUCGUGGUCCUUAAAUGUGCGGGUAG

Slide 39 of 39 Copyright Pearson Prentice Hall DNA CodonmRNA codon tRNA anticodon Amino Acid AAAUUUAAAPHENYL GTC GGAGLYCINE METH/START GAT GUGVALINE

Slide 40 of 39 Copyright Pearson Prentice Hall CHNOPS LAB DNA: TAC AGG GCG ATT mRNA:____________________ tRNA:______________________ Amino Acid sequence: ____________________________________ Trait: _____________________ AMINO ACID SEQUENCE TRAIT Methionine-threonine-glycine-tyrosine-Hairless Methionine- threonine-glycine-glycineHairy Methionine- threonine-proline-prolinePlump Methionine- tyrosine-glycine-lysineSkinny Methionine-serine-arginineFour-eyed Methionine-serine-tyrosineTwo-eyed Methionine-glycine-arginine-lysine-prolineLong nose Methionine- proline-arginine-lysine-prolineShort nose Methionine-phenylalanine-lysineNo freckles Methionine- phenylalanine-asparagineFreckles Methionine- glycine-arginine-arginineBlue skin Methionine- glycine-arginine-phenylalanineOrange skin Methionine-isoleucine-isoleucine-leucineMale Methionine-isoleucine-isoleucine-glycineFemale

Slide 41 of 39 Processing pre-mRMA into mature mRNA: Copyright Pearson Prentice Hall Section 1 C G T A G A T A T A A A A G C T T A C A T G A C A T G A A T T C G C A T C T A T A T T T T C G A A T G T A C T G T A C T T A A G Section 2 T A T C C G A A T T C T A C A A C T G A A T T C C G G T T T G T A A T A G G C T T A A G A T G T T G A C T T A A G G C C A A A C A T Section 3 A A A A A A T G T T T T T T A C 1. Cut out sections 1-3 of DNA and tape together in order.

Slide 42 of 39 Copyright Pearson Prentice Hall 2. Locate the beginning of the gene on the sense side of DNA (Top line) and underline it. How? TATA Box 3.Locate the end of the gene on the sense side of DNA and underline it. How? poly-A-tail

Slide 43 of 39 Copyright Pearson Prentice Hall 4. Act like RNA polymerase….. How? Use your scissors to cut apart the sense and antisense sides of DNA beginning at the end of the TATA and going to the beginning of the poly-A-tail. Section 1 C G T A G A T A T A A A A G C T T A C A T G A C A T G A A T T C G C A T C T A T A T T T T C G A A T G T A C T G T A C T T A A G

Slide 44 of 39 Copyright Pearson Prentice Hall 5. Number the DNA nucleotides 1-54 (start at end of TATA and to the beginning of the poly- a-tail. 6. Put in slashes, dividing it into 3’s or codons. Section 1 C G T A G A T A T A A A A G C T T A C A T G A C A T G A A T T C G C A T C T A T A T T T T C G A A T G T A C T G T A C T T A A G

Slide 45 of 39 Copyright Pearson Prentice Hall 7. Cut out the two sections of pre-RNA and tape together. Put in slashes, dividing it into 3’s or codons. 8.Complete the process of transcription. How? You now have just made pre-mRNA

Slide 46 of 39 Copyright Pearson Prentice Hall 9. Locate the beginning of a protein. How? Start codon AUG 10.Locate the end of a protein. How? Stop codon UAA UAG UGA 11. Locate the next set of start and stop codons.

Slide 47 of 39 Copyright Pearson Prentice Hall 12.Label the introns and exons. Introns: Non coding Exons: Express……codes for a protein 13.Cut out the introns. 14.Tape together the exons. 15.Add a protective 5’ cap to the front and a protective poly-A-tail tail to the end. These protect the mature mRNA from harmful enzymes in the cytoplasm.