What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.

Slides:



Advertisements
Similar presentations
RNA and Protein Synthesis
Advertisements

CH 11.4 & 11.5 “DNA to Polypeptide”.
RNA and Protein Synthesis
RNA and Protein Synthesis
RNA and Protein Synthesis
10-2: RNA and 10-3: Protein Synthesis
RNA Transcription.
Lesson Overview 13.1 RNA.
13.1 RNA.
Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.
RNA and Protein Synthesis
RNA AND PROTEIN SYNTHESIS RNA vs DNA RNADNA 1. 5 – Carbon sugar (ribose) 5 – Carbon sugar (deoxyribose) 2. Phosphate group Phosphate group 3. Nitrogenous.
VII RNA and Protein Synthesis
Transcription and Translation
Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis
By: Anne Russell, Madelyn Stroder, Hannah Black, And Bailey Mills.
The Genetic Code.
RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.
Copyright Pearson Prentice Hall
Lesson Overview Lesson OverviewFermentation Lesson Overview 13.1 RNA.
RNA & Protein Synthesis
Structure of DNA DNA is made up of a long chain of nucleotides
Lesson Overview Lesson OverviewFermentation Objectives 13.1 RNA -Contrast RNA and DNA. -Explain the process of transcription.
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
Protein Synthesis. The DNA Code The order of bases along the DNA strand codes for the order in which amino acids are chemically joined together to form.
Placed on the same page as your notes Warm-up pg. 48 Complete the complementary strand of DNA A T G A C G A C T Diagram 1 A T G A C G A C T T A A C T G.
RNA and Protein Synthesis. RNA Structure n Like DNA- Nucleic acid- composed of a long chain of nucleotides (5-carbon sugar + phosphate group + 4 different.
13.1 RNA 13.2 Ribosomes & Protein Synthesis
Chapter 13 – RNA & Protein Synthesis MS. LUACES HONORS BIOLOGY.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
Gene Expression DNA, RNA, and Protein Synthesis. Gene Expression Genes contain messages that determine traits. The process of expressing those genes includes.
CH 12.3 RNA & Protein Synthesis. Genes are coded DNA instructions that control the production of proteins within the cell…
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
End Show 12–3 RNA and Protein Synthesis Slide 1 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis 106. What are genes? They are coded.
 Genes are coded DNA instructions that will control the production of proteins  These messages have to change to RNA to be decoded.  RNA will give.
Chapter 13 From DNA to Proteins
Notes: Transcription DNA vs. RNA
RNA and Protein Synthesis
RNA & Protein synthesis
12-3 RNA & Protein Synthesis
Protein Synthesis.
Protein Synthesis.
12-3 RNA and Protein Synthesis
BIOLOGY NOTES GENETICS PART 7 PAGES
Protein Synthesis.
13.1 RNA.
BIOLOGY NOTES GENETICS PART 7 PAGES
RNA Ribonucleic Acid.
12-3 RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
BIOLOGY NOTES GENETICS PART 7 PAGES
RNA and Protein Synthesis
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
Lesson Overview 13.1 RNA
12-3 RNA and Protein Synthesis
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Comparing RNA and DNA Each nucleotide in both DNA and RNA is made up of a 5-carbon sugar, a phosphate group, and a nitrogenous base. There are three important.
Transcription/ Translation Notes 16-17
BIOLOGY NOTES GENETICS PART 7 PAGES
12-3 RNA and Protein Synthesis
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
RNA and Protein Synthesis
Genes and Protein Synthesis Review
RNA & Protein Synthesis
Protein Synthesis.
Protein Synthesis.
Presentation transcript:

What organic molecule is DNA? Nucleic Acid

An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA

What differences do you see between DNA and RNA?

Differences between RNA and DNA 1. Sugar in RNA is ribose instead of deoxyribose. 2. RNA is generally single stranded, not double stranded. 3. RNA contains uracil instead of thymine

RNA Is a disposable copy of a segment of DNA FUNCTION: Main function is protein synthesis.

Types of RNA Messenger RNA (mRNA) the RNA molecule that carries the copies of instructions for assembling amino acids. Ribosomal RNA (rRNA) the RNA that combined with many other proteins, make up the ribosomes that assemble proteins Transfer RNA (tRNA) carries amino acids to the ribosomes and matches them to the coded mRNA

What are the 3 differences between DNA and RNA? RNA is a single strand, DNA double RNA has ribose sugar in it, DNA has deoxyribose sugar RNA has the nitrogenous base uracil, DNA has thymine

How is RNA made? By process called transcription. Transcription – process in which segments of DNA serve as templates to produce complementary RNA molecules.

Where transcription occurs In prokaryotes it occurs in the cytoplasm In eukaryotes it occurs in the nucleus.

Transcription 1.The enzyme RNA polymerase attaches to DNA strand 2.RNA polymerase separates the DNA strands 3.RNA polymerase uses one strand to assemble nucleotides into RNA

Where does transcription start? The enzyme RNA polymerase binds to special regions on the DNA called promoters. Promoters – specific base sequences on the DNA that act as signals to show RNA polymerase where to begin transcription

RNA editing Before the RNA can move on to make proteins it must be “edited.” Pieces of the RNA are cut out. The pieces that are cut out are called introns. The pieces remaining in the RNA are called exons.

What is transcription? The process of making RNA from a strand of DNA

nimat/molgenetics/transcription.swf nimat/molgenetics/transcription.swf

How is RNA used to make proteins? The nitrogenous bases act as a code for making proteins

Genetic code – The language consisting of 4 letters (A, C, G, and U) that gives the instructions for building amino acids The code is read three “letters” at a time, so each “word” is three bases long

codon – the three letter word that corresponds to a single amino acid

There are 64 different 3 letter combinations of the 4 bases A,T,C and G (so 64 codons) But there are only 20 amino acids. Why aren’t there 64 amino acids? Most amino acids can have more than one codon that codes for them ex. UUA, UUG, CUU, CUC, CUA and CUG all code for the amino acid tryptophan

There are also codons that that code for the beginning and ending of protein synthesis. “start” codons – where the reading of the mRNA begins. (The amino acid methionine is a start codon) “stop” codon- where the reading ends.

*Amino acids bond together to make a polypeptide chain. **Polypeptides- long chains of amino acids joined together.

The amino acids in a polypeptide, and the order in which they are joined, determine the properties of the different proteins.

What do codons “code” for? Amino Acids

Translation After transcription the mRNA strand is ready to start the process of protein synthesis. What part of the cell makes proteins? Ribosomes Ribosomes use the sequence of codons in mRNA to assemble amino acids into polypeptide chains.

Translation- The decoding of an mRNA message into a protein (Ribosomes translate the code)

Translation Translation is carried out by ribosomes in the cytoplasm. Step 1: A ribosome attaches to mRNA

Translation Step 2: As each codon passes through ribosome, tRNAs bring the proper amino acid to the ribosome.

tRNA Each tRNA molecule carries just one kind of amino acid. Each tRNA has 3 unpaired bases called an anticodon. Each tRNA anticodon is complementary to one mRNA codon

Translation Step 3: The ribosomes attach the amino acids to the growing chain.

Translation Step 4: The ribosomes helps form a peptide bond between the first and second amino acid.

Translation Step 5: The ribosome then moves to the next codon

Translation Step 6: Polypeptide chain continues to grow until ribosome reaches the stop codon

cs/translation.sw f

How are proteins related to traits? Many proteins are enzymes, which catalyze and regulate chemical reactions. Proteins regulate patterns of growth, patterns of development in humans, and they build or operate different components of a living cell.

The Central Dogma Information is transferred from DNA to RNA protein