[BejeranoFall13/14] 1 MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano TAs: Harendra Guturu & Panos.

Slides:



Advertisements
Similar presentations
Methods to read out regulatory functions
Advertisements

Bio 402/502 Section II, Lecture 2 Nuclear Processes: DNA replication and transcription Dr. Michael C. Yu.
Gene Expression Chapter Eleven. What is Gene Expression? When a gene is expressed – that gene’s protein product is made: 1.DNA is transcribed into RNA.
Outline Questions from last lecture? P. 40 questions on Pax6 gene Mechanism of Transcription Activation –Transcription Regulatory elements Comparison between.
Combined analysis of ChIP- chip data and sequence data Harbison et al. CS 466 Saurabh Sinha.
Transcription of viral DNAs. Lecture 14 Flint et al. pp. 253 – 277.
CH. 11 : Transcriptional Control of Gene Expression Jennifer Brown.
Detecting DNA-protein Interactions Xinghua Lu Dept Biomedical Informatics BIOST 2055.
Speaker: HU Xue-Jia Supervisor: WU Yun-Dong Date: 19/12/2013.
Section 8.6: Gene Expression and Regulation
Genome-wide prediction and characterization of interactions between transcription factors in S. cerevisiae Speaker: Chunhui Cai.
[Bejerano Aut08/09] 1 MW 11:00-12:15 in Beckman B302 Profs: Serafim Batzoglou, Gill Bejerano TA: Cory McLean.
[Bejerano Fall10/11] 1 Thank you for the midterm feedback! Projects will be assigned shortly.
Profs: Serafim Batzoglou, Gill Bejerano TAs: Cory McLean, Aaron Wenger
[Bejerano Spr06/07] 1 TTh 11:00-12:15 in Clark S361 Profs: Serafim Batzoglou, Gill Bejerano TAs: George Asimenos, Cory McLean.
[Bejerano Aut07/08] 1 MW 11:00-12:15 in Redwood G19 Profs: Serafim Batzoglou, Gill Bejerano TA: Cory McLean.
The Hardwiring of development: organization and function of genomic regulatory systems Maria I. Arnone and Eric H. Davidson.
Chapter 17 AP Biology From Gene to Protein.
CS 374: Relating the Genetic Code to Gene Expression Sandeep Chinchali.
[Bejerano Fall09/10] 1 Thank you for the midterm feedback!
[Bejerano Aut08/09] 1 MW 11:00-12:15 in Beckman B302 Profs: Serafim Batzoglou, Gill Bejerano TAs: Cory McLean, Aaron Wenger.
CS262 Lecture 17, Win07, Batzoglou Gene Regulation and Microarrays.
(CHAPTER 12- Brooker Text)
[BejeranoWinter12/13] 1 MW 11:00-12:15 in Beckman B302 Prof: Gill Bejerano TAs: Jim Notwell & Harendra Guturu CS173 Lecture 3:
[BejeranoFall13/14] 1 MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano TAs: Harendra Guturu & Panos.
[BejeranoWinter12/13] 1 MW 11:00-12:15 in Beckman B302 Prof: Gill Bejerano TAs: Jim Notwell & Harendra Guturu CS173 Lecture 7:
Promoter structure and gene regulation. Bacterial Promoters Source:
CS273A Lecture 5: Genes Enrichment, Gene Regulation I
[BejeranoWinter12/13] 1 MW 11:00-12:15 in Beckman B302 Prof: Gill Bejerano TAs: Jim Notwell & Harendra Guturu CS173 Lecture 8:
[BejeranoFall13/14] 1 MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano TAs: Harendra Guturu & Panos.
[BejeranoFall13/14] 1 MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano TAs: Harendra Guturu & Panos.
ENCODE enhancers 12/13/2013 Yao Fu Gerstein lab. ‘Supervised’ enhancer prediction Yip et al., Genome Biology (2012) Get enhancer list away to genes DNase.
Introduction to gene expression Seema Zargar. Lecture outline Introduction to all terms used in Gene expression.
Chap. 7 Problem 1 In glucose media without lactose, the lac repressor is bound to the lac operator, and the CAP protein is not bound to its control site.
Control of Gene Expression Eukaryotes. Eukaryotic Gene Expression Some genes are expressed in all cells all the time. These so-called housekeeping genes.
Mapping protein-DNA interactions by ChIP-seq Zsolt Szilagyi Institute of Biomedicine.
Introns and Exons DNA is interrupted by short sequences that are not in the final mRNA Called introns Exons = RNA kept in the final sequence.
* only 17% of SNPs implicated in freshwater adaptation map to coding sequences Many, many mapping studies find prevalent noncoding QTLs.
Reconstruction of Transcriptional Regulatory Networks
Introduction to Gene Expression
Thank you for the midterm feedback!
Biochemistry Sixth Edition Chapter 31 The Control of Gene Expression Part II: Eukaryotes (cis vs. trans) Copyright © 2007 by W. H. Freeman and Company.
Recombination breakpoints Family Inheritance Me vs. my brother My dad (my Y)Mom’s dad (uncle’s Y) Human ancestry Disease risk Genomics: Regions  mechanisms.
[BejeranoFall15/16] 1 MW 1:30-2:50pm in Clark S361* (behind Peet’s) Profs: Serafim Batzoglou & Gill Bejerano CAs: Karthik Jagadeesh.
Molecular Basis for Relationship between Genotype and Phenotype DNA RNA protein genotype function organism phenotype DNA sequence amino acid sequence transcription.
Last Class 1. Transcription 2. RNA Modification and Splicing
Analysis of ChIP-Seq Data Biological Sequence Analysis BNFO 691/602 Spring 2014 Mark Reimers.
CS173 Lecture 9: Transcriptional regulation III
[BejeranoFall15/16] 1 MW 1:30-2:50pm in Clark S361* (behind Peet’s) Profs: Serafim Batzoglou & Gill Bejerano CAs: Karthik Jagadeesh.
Biol 456/656 Molecular Epigenetics Lecture #5 Wed. Sept 2, 2015.
Outline Molecular Cell Biology Assessment Review from last lecture Role of nucleoporins in transcription Activators and Repressors Epigenetic mechanisms.
Conclusions (last lecture)
Nawanol Theera-Ampornpunt, Seong Gon Kim, Asish Ghoshal, Saurabh Bagchi, Ananth Grama, and Somali Chaterji Fast Training on Large Genomics Data using Distributed.
Genes in ActionSection 2 Section 2: Regulating Gene Expression Preview Bellringer Key Ideas Complexities of Gene Regulation Gene Regulation in Prokaryotes.
Enhancers and 3D genomics Noam Bar RESEARCH METHODS IN COMPUTATIONAL BIOLOGY.
CS273A Lecture 6: Gene Regulation II MW 12:50-2:05pm in Beckman B100
Context Cell nucleus chromosome gene double helix.
CS273A Lecture 7: Genes Enrichment, Gene Regulation I
Albert Xue, Binbin Huang, Jianrong Wang
Relationship between Genotype and Phenotype
CS273A Lecture 9: Gene Regulation II
Relationship between Genotype and Phenotype
A Zero-Knowledge Based Introduction to Biology
Relationship between Genotype and Phenotype
Even-skipped gene regulation
Relationship between Genotype and Phenotype
The Human Genome Source Code
The Human Genome Source Code
The Human Genome Source Code
Relationship between Genotype and Phenotype
Presentation transcript:

[BejeranoFall13/14] 1 MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano TAs: Harendra Guturu & Panos Achlioptas CS273A Lecture 5: Transcription Regulation I

[BejeranoFall13/14] 2 Announcements HW1 is out. Due by AM Friday, October 18. –Check it out.

[BejeranoFall13/14] 3 TTATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA CATATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC AGTAATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC CGTGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT AGCTTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG ATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAA AAGCTGCATAACCACTTTAACTAATACTTTCAACATTTTCAGTTTGTATTACTTCTTATTCAAATGTCATAAAAGTATCAACAAAAAAT TGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACTATAATGACTAAATCTCATTCAGAAGAAGTGATTGTACCTGAGTTCAA TTCTAGCGCAAAGGAATTACCAAGACCATTGGCCGAAAAGTGCCCGAGCATAATTAAGAAATTTATAAGCGCTTATGATGCTAAACCGG ATTTTGTTGCTAGATCGCCTGGTAGAGTCAATCTAATTGGTGAACATATTGATTATTGTGACTTCTCGGTTTTACCTTTAGCTATTGAT TTTGATATGCTTTGCGCCGTCAAAGTTTTGAACGATGAGATTTCAAGTCTTAAAGCTATATCAGAGGGCTAAGCATGTGTATTCTGAAT CTTTAAGAGTCTTGAAGGCTGTGAAATTAATGACTACAGCGAGCTTTACTGCCGACGAAGACTTTTTCAAGCAATTTGGTGCCTTGATG AACGAGTCTCAAGCTTCTTGCGATAAACTTTACGAATGTTCTTGTCCAGAGATTGACAAAATTTGTTCCATTGCTTTGTCAAATGGATC ATATGGTTCCCGTTTGACCGGAGCTGGCTGGGGTGGTTGTACTGTTCACTTGGTTCCAGGGGGCCCAAATGGCAACATAGAAAAGGTAA AAGAAGCCCTTGCCAATGAGTTCTACAAGGTCAAGTACCCTAAGATCACTGATGCTGAGCTAGAAAATGCTATCATCGTCTCTAAACCA GCATTGGGCAGCTGTCTATATGAATTAGTCAAGTATACTTCTTTTTTTTACTTTGTTCAGAACAACTTCTCATTTTTTTCTACTCATAA CTTTAGCATCACAAAATACGCAATAATAACGAGTAGTAACACTTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGA TAATGTTTTCAATGTAAGAGATTTCGATTATCCACAAACTTTAAAACACAGGGACAAAATTCTTGATATGCTTTCAACCGCTGCGTTTT GGATACCTATTCTTGACATGATATGACTACCATTTTGTTATTGTACGTGGGGCAGTTGACGTCTTATCATATGTCAAAGTTGCGAAGTT CTTGGCAAGTTGCCAACTGACGAGATGCAGTAACACTTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGT TTTCAATGTAAGAGATTTCGATTATCCACAAACTTTAAAACACAGGGACAAAATTCTTGATATGCTTTCAACCGCTGCGTTTTGGATAC CTATTCTTGACATGATATGACTACCATTTTGTTATTGTACGTGGGGCAGTTGACGTCTTATCATATGTCAAAGTCATTTGCGAAGTTCT TGGCAAGTTGCCAACTGACGAGATGCAGTTTCCTACGCATAATAAGAATAGGAGGGAATATCAAGCCAGACAATCTATCATTACATTTA AGCGGCTCTTCAAAAAGATTGAACTCTCGCCAACTTATGGAATCTTCCAATGAGACCTTTGCGCCAAATAATGTGGATTTGGAAAAAGA GTATAAGTCATCTCAGAGTAATATAACTACCGAAGTTTATGAGGCATCGAGCTTTGAAGAAAAAGTAAGCTCAGAAAAACCTCAATACA GCTCATTCTGGAAGAAAATCTATTATGAATATGTGGTCGTTGACAAATCAATCTTGGGTGTTTCTATTCTGGATTCATTTATGTACAAC CAGGACTTGAAGCCCGTCGAAAAAGAAAGGCGGGTTTGGTCCTGGTACAATTATTGTTACTTCTGGCTTGCTGAATGTTTCAATATCAA CACTTGGCAAATTGCAGCTACAGGTCTACAACTGGGTCTAAATTGGTGGCAGTGTTGGATAACAATTTGGATTGGGTACGGTTTCGTTG GTGCTTTTGTTGTTTTGGCCTCTAGAGTTGGATCTGCTTATCATTTGTCATTCCCTATATCATCTAGAGCATCATTCGGTATTTTCTTC TCTTTATGGCCCGTTATTAACAGAGTCGTCATGGCCATCGTTTGGTATAGTGTCCAAGCTTATATTGCGGCAACTCCCGTATCATTAAT GCTGAAATCTATCTTTGGAAAAGATTTACAATGATTGTACGTGGGGCAGTTGACGTCTTATCATATGTCAAAGTCATTTGCGAAGTTCT TGGCAAGTTGCCAACTGACGAGATGCAGTAACACTTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTT TCAATGTAAGAGATTTCGATTATCCACAAACTTTAAAACACAGGGACAAAATTCTTGATATGCTTTCAACCGCTGCGTTTTGGATACCT ATTCTTGACATGATATGACTACCATTTTGTTATTGTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTT TCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGA GATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTA TCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTT CATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTT CAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAA TAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGT ATGATAATGTTTTCAATGTAAGAGATTTCGATTATCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATAAAG

4 Gene Products reverse transcription long non-coding RNA microRNA rRNA, snRNA, snoRNA

Gene Regulatory Switches [BejeranoFall13/14] 5 Gene = genomic substring that encodes HOW to make a protein (or ncRNA). Genomic switch = genomic substring that encodes WHEN, WHERE & HOW MUCH of a protein to make. [1,0,0,1] [1,1,0,0] [0,1,1,1] Gene B N B N H H

If you only measure gene expression [BejeranoFall13/14]6 It’s like only seeing the values change in RAM as a program is running.

Cis (=close) regulatory elements [BejeranoFall13/14] 7 CIS REGULATION Type# in genome% of genome genes25,0002% ncRNA15,0001% cis elements1,000,000>10% Encode causality Disease susceptibility Driver sequences Alter cell state Key for evolution promoters, enhancers, silencers, insulators

[BejeranoFall13/14] 8 Transcription Activation

RNA Polymerase Transcription = Copying a segment of DNA into (non/coding) RNA Gene transcription starts at the (aptly named) TSS, or gene transcription start site Transcription is done be RNA polymerase, a complex of subunit proteins. There are three types of RNA polymerases in human: –RNA pol I synthesizes ribosomal RNAs –RNA pol II synthesizes pre-mRNAs and most microRNAs –RNA pol III synthesizes tRNAs, rRNA and other ssRNAs [BejeranoFall13/14] 9 RNA Polymerase TSS

RNA Polymerase is General Purpose RNA Polymerase is the general purpose transcriptional machinery. It generally does not recognize gene transcription start sites by itself, and requires interactions with multiple additional proteins. [BejeranoFall13/14] 10 general purpose context specific

Terminology Transcription Factors (TF): Proteins that return to the nucleus, bind specific DNA sequences there, and affect transcription. –There are 1,200-2,000 TFs in the human genome (out of 20-25,000 genes) –Only a subset of TFs may be expressed in a given cell at a given point in time. Transcription Factor Binding Sites: 4-20bp stretches of DNA where TFs bind. –There are millions of TF binding sites in the human genome. –In a cell at a given point in time, a site can be either occupied or unoccupied. [BejeranoFall13/14] 11

Terminology Promoter: The region of DNA 100-1,000bp immediately “upstream” of the TSS, which encodes binding sites for the general purpose RNA polymerase associated TFs, and at times some context specific sites. –There are as many promoters as there are TSS’s in the human genome. Many genes have more than one TSS. Enhancer: A region of 100-1,000bp up to 1Mb or more upstream or downstream from the TSS that includes binding sites for multiple TFs. When bound by (the right) TFs an enhancer turns on/accelerates transcription. –Note how an enhancer (E) very far away in sequence can in fact get very close to the promoter (P) in space. [BejeranoFall13/14] 12 promoter TSS gene

[BejeranoFall13/14] 13 TFBS Position Weight Matrix (PWM) Note the strong independence assumption between positions. Holds for most transcription binding profiles in the human genome.

Promoters [BejeranoFall13/14]14

Enhancers [BejeranoFall13/14]15

Terminology Gene regulatory domain: the full repertoire of enhancers that affect the expression of a (protein coding or non-coding) gene, at some cells under some condition. –Gene regulatory domains do not have to be contiguous in genome sequence. –Neither are they disjoint: One or more enhancers may well affect the expression of multiple genes (at the same or different times). [BejeranoFall13/14] 16 TSS promoter enhancers for different contexts

[BejeranoFall13/14] 17 Imagine a giant state machine Gene Transcription factors bind DNA, turn on or off different promoters and enhancers, which in-turn turn on or off different genes, some of which may themselves be transcription factors, which again changes the presence of TFs in the cell, the state of active promoters/enhancers etc. Proteins DNA transcription factor binding site

[BejeranoFall13/14] 18 One nice hypothetical example requires active enhancers to function functions independently of enhancers

[BejeranoFall13/14] 19 The State Space Discrete, but very large. All states served by same genome(!) cells 1 cell

[BejeranoFall13/14] 20 Transcription Activation: Some measurements and observations

Transcription Factor Binding Sites (TFBS) An antibody is a large Y-shaped protein used by the immune system to identify and neutralize foreign objects such as bacteria. Antibodies can be raised that instead recognize specific transcription factors. Chromatin Immunoprecipitation followed by deep sequencing (ChIP-seq): Take DNA (region or whole genome) bound by TFs, crosslink DNA-TFs, shear DNA, select DNA fragments bound by TF of interest using antibody, get rid of TF and antibody, sequence pool of DNA.  Obtain genomic regions bound by TF. [BejeranoFall13/14] 21

[BejeranoFall13/14] 22 ChIP-seq  Position Weight Matrix Computational challenge: The sequenced DNA fragments are bp. In each is one or more instance of the 6-20bp motif. Find it…

Transcription Factors have Large “fan outs” We could have had one TF regulate two TFS, each of which regulates two other TFs, etc. and each of those contributing to the regulation of a modest number of target genes (that do the real work). Instead TFs reproducibly bind to thousands of genomic locations almost anywhere we’ve looked. Gene regulation forms a dense network. [BejeranoFall13/14] 23

[BejeranoFall13/14] 24 Transfections enhancerreporter gene minimal promoter in cellular context of choice As far as we’ve seen, enhancers work “the same” irrespective of distance (or orientation) to TSS, or identity of target gene. Which enhancers work in what contexts? What if you mutate enhancer bases (disrupt or introduce binding sites) and run the experiment again? What if you co-transfect a TF you think binds to this enhancer? What if you instead add siRNA for that TF?

25 Transcription factors bind synergistically, often with preferred spacing Adapted from Kamach et al., Genes Dev, 2001 Sox:1 bp:Pax Sox2 Pax6 Sox2Pax Fold activation Sox2 Pax6 Sox2Pax Fold activation Transcription factor complexes prefer specific spacings! Sox:3 bp:Pax {+2} [BejeranoFall13/14]

26 Strict spacing between binding sites is important for structural interactions [BejeranoFall13/14]

If a complex prefers TF : spacer : TF This pattern may be abundant in the genome 27 Complexes may leave genomic footprints TAAACAGGAAGT AAAACAGGAATA ATAACAGGATGC TTAACAGGAAAG TAAACAGGATAG AAAACAGGAAAA [BejeranoFall13/14] Can we read complexes from individual predictions?

Cooperative binding of complexes can be detected as the co-occurrence of individuals 28 Each dot = different spacer [BejeranoFall13/14]

Co-occurrences can be filtered for only structurally feasible patterns Fox { spacer } Ets Remove physically incompatible configurations = = 29 compatibleincompatible [BejeranoFall13/14]

Complex motifs were grouped to reduce redundancy Statistically Significant (p < 1×10 -8 ) & valid motifs 300 transcription factor motifs 6,548,947 motif spacing combinations Started with: 6,180 significant motif spacing combinations Found: unique complex motifs Grouping Fox { spacer } Ets Searched: (TF1 {spacer} TF2) [BejeranoFall13/14]

31 Transgenics enhancerreporter gene minimal promoter Observe enhancer behavior in vivo. Qualitative (not quantitative) assay. Can section and stain to obtain more specific cell-type information.

[BejeranoFall13/14] 32 BAC transgenics: necessity vs sufficiency You can take kb segments out of the genome, insert a reporter gene in place of gene X, and measure regulatory domain expression. You can then continue to delete or mutate individual enhancers.

[BejeranoFall13/14] 33 Gene Regulation: Enhancers are modular and additive Sall1 limb neural tube brain Temporal gene expression pattern “equals” sum of promoter and enhancers expression patterns.

Genome Engineering Technologies are in fact constantly improving that allow us to edit the nuclear genome itself. Edit the genome of an embryonic stem cell, breed homozygous modified animals. [BejeranoFall13/14] 34

Chromosome conformation capture (3C) People are also developing methods to detect when two genomic regions far in sequence are in fact interacting in space. Ultimately this will allow to determine experimentally the regulatory domain of each gene (likely condition dependent). [BejeranoFall13/14] 35

4C example result (in a single context) [BejeranoFall13/14]36 TSS probe Irreproducible peaks

Gene Regulation is HOT Despite its complexity gene regulation is currently one of the hottest topics in the study of the human genome. Large projects are pouring tons of money to generate huge descriptive datasets. The challenge now is to glean logic from these piles. [BejeranoFall13/14] 37 To be continued…