PCR – Polymerase chain reaction Lecturer: David

Objective Review DNA replication, knowledge of the process, and how it occurs. The concept of PCR The purpose of DNA and RNA extraction relative to PCR. The process of PCR the purpose of a primer Brief background of history of taq and its purpose in PCR

DNA replication Replication allows our genetic material to be passed on to daughter cells.

Replication review

Replication Overview Origin of replication Helicase SSB RNA primase

Replication Review Leading strand Lagging strand Continuous Discontinuous Okazaki fragments

PCR is a technique used to AMPLIFY a few copies of DNA exponentially. What is PCR??? PCR is a technique used to AMPLIFY a few copies of DNA exponentially.

Purpose for Amplification Very small samples can be amplified and analyzed DNA found at crime scene investigations Paternity test Diagnosis (ex. Viral load in HIV)

How does it work? You need 5 things: Template DNA Primers Thermal cycling – increase and decrease the temperature taq DNA polymerase dNTPs

What’s a primer? A primer is a sequence necessary for replication, which binds to a target DNA sequence DNA polymerase requires a primer to begin synthesizing a complementary strand

dNTPs Deoxynucleoside triphosphates Triphosphate Sugar – deoxyribose Nitrogenous base A T C G

Thermal cycler Machine used for PCR amplification Raises and lower temperatures for temperature sensitive reactions

Steps for PCR Step 1: Denaturing Heat 94-98°C Causes the DNA to separate by disrupting the hydrogen bonds between strands

Steps for PCR Step 2: Annealing Lower temperature to 50-65°C Allows primer to bind to DNA strand – H bonding between DNA and primers One primer binds to 5’ end and one to 3’ end

Steps for PCR Step 3: Elongation Temperature depends on polymerase you use taq DNA polymerase works best at 75-80°C Polymerase add dNTPs to primer and extends the strand.

The history of taq Heating inactivates the DNA polymerase used before taq was discovered  Researchers needed a DNA polymerase that didn’t need replacing after every round of PCR taq DNA polymerase was discovered in bacteria called Thermus aquaticus that lived in underwater hydrothermal vents

taq DNA polymerase!

Overview This cycle of heating and cooling is repeated many times to amplify the amount of DNA.

PCR Video http://www.youtube.com/watch?v=qKlMEdZ7g4Y

Gel Electrophoresis Run product on an agarose gel Electric current is run through the gel to separate product based on size Ensures the correct product was amplified

Gel electrophoresis Ladder – DNA solution of varying sizes and used to compare samples Positive control – a group where you expect an outcome Negative control – a group where you expect nothing to happen Larger fragments are closer to the top

Questions What is the purpose of PCR?

Answer To amplify small amounts of DNA

Question What are the 3 steps for PCR?

Answer

Questions If your DNA template strand sequence was 5’AGCTAGGCTAACTGCCGGGC 3’, what would your primer sequences be if they were 4 bases long?

Answer 3’TCGA5’ 5’GCCC3’

Questions Why do we use a taq DNA polymerase?

Answer It can be used at higher temperatures, unlike previous enzymes which denatured at these temperature.

Lab today Today you will be doing PCR on a crime scene investigation 2 DNA samples were taken from the crime scene One was skin The other is saliva There are 2 suspects: Trisha Jones, and Neil Burns

Lab today You will perform PCR on the DNA samples to amplify it. The samples will be run on an agarose gel by electrophoresis to compare the DNA found at the crime scene to the suspects.

Lab today There will 2 gels per lab. 2-3 groups will run one gel. Each gel has 8 wells to run samples.

Lab today Victim’s DNA Suspect 1 DNA Suspect 2 DNA Saliva Skin Negative control Positive control DNA ladder

Lab today Objective: To understand the importance of PCR and carry out a PCR reaction Hypothesis: Amplification of the DNA found at the crime scene will match that of the criminal