Emily Buckhouse
Nitrogenous Bases
Nucleosides Base linked to a 2-deoxy-D-ribose at 1’ carbon Nucleotides Nucleosides with a phosphate at 5’ carbon
Phosphodiester Bond DNA Polymerase
Determining the Sequence of DNA Methods: 1. Chain termination or dideoxy method F. Sanger 2. Shotgun sequence method 3. 2 nd generation sequence methods Pyrosequencing
Dideoxy (Sanger) Method 4 Steps: 1. Denaturation 2. Primer attachment and extension of bases 3. Termination 4. Gel electrophoresis
Overview: Dideoxy (Sanger) Method Gel electrophoresis 5
Dideoxy (Sanger) Method ddNTP- 2’,3’- dideoxynucleotide No 3’ hydroxyl Terminates chain when incorporated Add enough so each ddNTP is randomly and completely incorporated at each base
Dideoxy Method Run four separate reactions each with different ddNTPs Run on a gel in four separate lanes Read the gel from the bottom up
Automated Version of the Dideoxy Method
So What’s Wrong With It? The dideoxy method is good only for bp reactions Expensive Takes a while The human genome is about 3 billion bp
Human Genome Project Began in 1990 Why? Human evolution Nature versus nurture Causes of disease
Shotgun Sequencing Used to sequence whole genomes Steps: DNA is broken up randomly into smaller fragments Dideoxy method produces reads Look for overlap of reads StrandSequence First Shotgun Sequence AGCATGCTGCAGTCATGCT TAGGCTA Second Shotgun Sequence AGCATG CTGCAGTCATGCTTAGGCTA Reconstruction AGCATGCTGCAGTCATGCTTAGGCTA
2 nd Generation: Pyrosequencing Sequencing by synthesis Advantages: Accurate Parallel processing Easily automated Eliminates the need for labeled primers and nucleotides No need for gel electrophoresis
Pyrosequencing Basic idea: Visible light is generated and is proportional to the number of incorporated nucleotides 1pmol DNA = 6*10 11 ATP = 6*10 9 photons at 560nm DNA Polymerase I from E.coli. pyrophospate From fireflies, oxidizes luciferin and generates light
Pyrosequencing 1 st Method Solid Phase ○ Immobilized DNA ○ 3 enzymes ○ Wash step to remove nucleotides after each addition
Pyrosequencing 2 nd Method Liquid Phase ○ 3 enzymes + apyrase (nucleotide degradation enzyme) Eliminates need for washing step In the well of a microtiter plate: primed DNA template 4 enzymes Nucleotides are added stepwise Nucleotide-degrading enzyme degrade previous nucleotides
Pyrosequencing Method:
Pyrosequencing Results:
Pyrosequencing Disadvantages Smaller sequences Nonlinear light response after more than 5-6 identical nucleotides
Summary DNA sequencing is a common procedure Dideoxy method Chain termination method Best for small DNA segments Whole genome shotgun sequencing Sequence human genome Fragments larger DNA strand to manageable chunks Pyrosequencing Sequence by synthesis Accurate and fast
References Applied Biosystems Automated DNA Sequence Chemistry Guide. (2000) Garrett & Grisham. (2007) Biochemistry. Thomson and Brooks/Cole. 3 rd ed. Pgs Maxam, A. & Gilbert, W. (1977) A new method for sequencing DNA. Proc. Natl. Acad. Sci. 74, Ronaghi, M. (2001) Pyrosequencing sheds light on DNA sequencing. Genome Res. 11, Sanger, F., Nicklen, S., & Coulson, A.R. (1977) DNA Sequencing with chain- terminating inhibitors. Proc. Natl. Acad. Sci. 94, Shendure, J. & Ji, H. (2008) Next-generation DNA Sequencing. Nature Biotech. 26, Venter, C, et al. (2001) The sequence of the human genome. Science. 291, 1304.