Lysogeny: Phage Entry into Bacterial Hosts Bobby Chaggar Yordanos Teferra.

Slides:

Advertisements

Similar presentations

Codon Bias and Regulation of Translation among Bacteria and Phages

Advertisements

Unknown Phage 11 Leah Liston Cluster Identification Unknown 11 is identified with Cluster Q Other Phage in Cluster Q – Long time singleton: Giles – Evanesce.

Phage BruceB, cluster G Et2Brutus, cluster A2.

Introduction to Bioinformatics Tuesday, 12 March.

Bacteriophage lambda (l) Transcriptional switches can regulate cellular decisions.

Site-specific mutagenesis of M13 clones

The CCA phage hunt 2013 Phage. Lab outline Isolate phage visualize phage Soil samples.

Bacteriophage lambda ( ) Transcriptional switches can regulate cellular decisions.

 Non-living entities  Can infect organisms of every domain  Commonly referred to by organism they infect  Viruses that infect bacteria: Bacteriophage.

Methods in the Development of Stable, Unmarked Recombinant BCG Vaccine Strains March 26, 2013 Prepared by: Charles Bourne Strictly Private and Confidential.

Introduction to Bioinformatics Wednesday, 2 March 2011 Genome analysis Hatfull et al (2008) Break up into research groups Organization of research groups.

Sequence comparisons June 23, 2009 Learning objectives-Understand the concept of sliding window programs. Understand difference between identity, similarity.

Microbial Genetics (Micr340)

Identifying recombination events in phage Giles through presence of repeat sequences MEGAN MAIR.

Bacteriophage Gene Functions Welkin Pope SEA-PHAGES In Silico Workshop, 2014.

Virus Replication. Animation Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in.

Printing: This poster is 48” wide by 36” high. It’s designed to be printed on a large-format printer. Customizing the Content: The placeholders in this.

Abstract Methods Results Discussion We have isolated a J cluster mycobacteriophage from a dumpster outside a student residence hall at Miami university.

Systematics, Taxonomy, Phylogeny and Evolution Systematics The systematic classification of organisms, the science of systematic classification and the.

Viruses Viral Structure Growing (Cultivating) Prokaryote Types Eukaryote Types Obligate Intracellular Parasites: Require living host cell in order to replicate.

N.De Lappe 1, D.Morris 2, G.Doran 1, J.O Connor 1, G.Corbett-Feeney 1,2, M.Cormican 1,2. National Salmonella Reference Laboratory, Medical Microbiology.

CAMPBELL BIOLOGY IN FOCUS © 2014 Pearson Education, Inc. Urry Cain Wasserman Minorsky Jackson Reece Lecture Presentations by Kathleen Fitzpatrick and Nicole.

Viruses Viral Structure Growing (Cultivating) Bacteriophage Life Cycles Obligate Intracellular Parasites: Require living host cell in order to replicate.

Specialized transduction Mozhan Haji Ghaffari Teacher: Dr. Ashraf Hosseini.

Purification and Analysis of the Mycobacteriophage Moses Amy E. Schade & Stephanie E. Simon, Department of Biological Sciences, College of Arts and Sciences.

Chapter 27 Viruses Joe Ganoe Jesus Trochez. Types of Viruses Plant Virus – Helical capsid shape Animal Virus – Icosahedral capsid Bacterial Virus – Icosahedral.

Jonathan Kindberg BNFO /24/2013 Is there a correlation between similar cluster phages’ tandem repeats within the tape measure protein and its location.

Genetics of Viruses.

“BSP, May I Be Excused? My Brain Is Full.” Gary Larson – The Far Side ASSESSMENT.

Identification of Tandem Repeats in Geobacillus and Heamophilious Phages Ramey Elsarrag.

Viruses and Infections

Bacteriophage Gene Functions Welkin Pope SEA-PHAGES Bioinformatics Workshop, 2015.

Bacteriophages By Monique Hunter.  Bacteriophages or phages are viruses that infect bacteria.  In 1917, French-canadian microbiologist Felix d’Herelle.

Identifying probable prophage DNA in mycobacterial genomes Bobby Chaggar BNFO 301 Lysogeny Group.

Chapter 19.  Non-living ◦ Non-cellular ◦ Cannot grow or reproduce on its own ◦ No metabolism  Cause disease ◦ AIDS, colds, flu, measles, mono  Cause.

IDENTIFICATION OF HIGHLY CONSERVED BACILLUS ORFS OF UNKNOWN FUNCTION.

IDENTIFICATION OF HIGHLY CONSERVED BACILLUS ORFS OF UNKNOWN FUNCTION.

Two Cycles and A Bit of Review Remember that viruses are not able to reproduce on their own. They rely on a ‘host cell’ for reproduction In the Lytic Cycle.

Images were sourced from the following web sites: Slide 2:commons.wikimedia.org/wiki/File:BorromeanRing...commons.wikimedia.org/wiki/File:BorromeanRing...

From High Street to Bishop Woods: The “Lives” of Two Phages Mary Owen, Andrew Schaff, Kayla Cartwright, Angel Chen, Jessica Clark, Bradley Davis, Paige.

Isolation and analysis of a collection of Gordonia terrae phages reveals novel aspects of lysis, virion morphology, and host range Matthew Benczkowski,

{ Viruses AP Biology Chapter 19.  Infectious N.A. enclosed in Proteins  Viral Genomes  4 – Several 100s of genes  DNA or RNA  Single or Double 

PHANTOME: Phage Annotation Tools And Methods Rob Edwards San Diego State University Argonne National Laboratory.

Cluster frequency for Phams found in Tortellini Genes 30-73

An Introduction to the Viruses

Molecular Mechanisms and lytic action of Bacteriophage.

Headings Vocab Important Info

Diagnostic luciferase reporter phage assay for active and non-replicating persistors to detect tubercle bacilli from sputum samples V.N.A. Dusthackeer,

attP region and attB regions

Predicting Genes in Actinobacteriophages

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Isolation and Annotation of Arthrobacteriophage

Viruses Are obligate intracellular parasites

Chapter 15 Viruses, Viral Life Cycles, Retroviruses.

Viruses Chapter 19.

Keeley Choy Bacteriophage.

Biotechnology Part 1 Genetics of Viruses

Are Viruses Alive?.

Transcriptional and translational map of HBV

Contemporary Phage Biology: From Classic Models to New Insights

Biotechnology Part 1 Genetics of Viruses

T4P gene clusters in C. perfringens and C. difficile.

Welkin Pope SEA-PHAGES Bioinformatics Workshop, 2017

Prophage genome map of the C. diphtheriae prophage encoding DT

Model of the development of PAI of pathogenic E. coli.

Molecular models for module exchange between phages.

Electron micrographs of bacteriophage T4.

Integron structure and gene capture mechanism.

Presentation transcript:

Lysogeny: Phage Entry into Bacterial Hosts Bobby Chaggar Yordanos Teferra

attP and attB regions attP site of L5 phage used in comparing phages and similar attB site of M. Smegmatis used in finding other att sites.

Search for Similar attP regions

Search for similar attB sites M. Segmatis: GCGGGCGTAGCTCAATGGTAGAGCCCTAG TCTTCCAAACTAGCTACGCGGGTTCGATTCCCGTCGCCCGCTC Msme-155.Msmeg-11642Msme-155.Msmeg ( > ) Aliases:(tRNA-Gly”) M. Vanbaalenii: GCGGGCGTAGCTCAATGGTAGAGCCCTAG TCTTCCAAACTAGCTACGCGGGTTCGATTCCCGTCGCCCGCTCCA Mvan-PYR-1.Mvan-PYR Mvan-PYR-1.Mvan-PYR ( > ) Aliases:(tRNA-Gly”) M. SP.JLS: GCGGGCGTAGCTCAATGGTAGAGCCCTAGTCTTCCAAACTAGCTACGCGGGTTCGATTCCCGTC GCCCGCTCCA M-JLS.Mjls-9576 M-JLS.Mjls-9576 ( > ) Aliases:(tRNA-Gly”)

The Search for Prophage DNA in Mycobacteria

Sliding Window

Deviations in GC content

Proteins to Consider Tail tape measure protein Phage major capsid protein Large-subunit terminase Integrase excisionase

References Gomathi, N.S.. "In silico analysis of mycobacteriophage Che12 genome: Characterization of genes required to lysogenise Mycobacterium tuberculosis." ScienceDirect. 31. (2007): Web. Hatful, Graham. "Characterization of the Mycobacteriophage L5 Attachment Site, attp." JMB (1997): Canchaya, C., Proux, C., Fournous, G., Bruttin, A., & Brussow, H. (2003). Prophage genomics. Microbiol Mol Biol Rev June; 67(2): 238–276. doi: /MMBR Hendrix, R., Smith, M., Burns, R., Ford, M., & Hatfull, G. (1999). Evolutionary relationships among diverse bacteriophages and prophages: All the world’s a phage. Proc Natl Acad Sci U S A March 2; 96(5): 2192–2197. Evolution. Karlin, S. (2001). Detecting anomalous gene clusters and pathogenicity islands in diverse bacterial genomes. TRENDS in Microbiology Vol.9 No.7 July 2001