Protein trafficking between membranes By Graham Warren & Ira Mellman

Slides:



Advertisements
Similar presentations
Intracellular Trafficking
Advertisements

Protein sorting and the Golgi apparatus
Lysosome Nucleus ER Plasma Membrane Mitochondria Golgi.
Chapter 13 Intracellular Vesicular Traffic 張學偉 助理教授.
Lesson 3: Translation.
Intracellular Transport1 Chapter 15 You should review functions of different organelles We already discussed evolution; review Focus will be on: 1) mechanisms.
Protein Sorting & Transport Paths of Protein Trafficking Nuclear Protein Transport Mitochondrial & Chloroplast Transport Experimental Systems Overview.
Bulk Transport/Vessicular Traffic Bulk transport refers to the transport of solutes enclosed in vesicles. Many of these solutes are too large to diffuse.
Unit 7 Endomembranes. SECRETORY PATHWAY: Unit 7 Secretory Pathway Proteins are synthesized on the Rough ER. Move via vesicles to Golgi Move via vesicles.
Javad Jamshidi Fasa University of Medical Sciences Proteins Into membranes and Organelles and Vesicular Traffic Moving.
Intracellular Compartments ER, Golgi, Endsomes, Lysosomes and Peroxisomes.
Last Class: 1. transportation at the plasma membrane A. carrier protein, B. channel protein 2. intracellular compartments A. nucleus, B. Endoplasmic Reticulum.
Lecture 18: Intracellular transport Flint et al., Chapter 12.
Protein Sorting ISAT 351, Spring 2004 College of Integrated Science and Technology James Madison University.
Endocytosis and Lysosome Formation The Endolytic Pathway.
Molecular mechanism of vesicular transport Vesicular pathway--Budding and fusion 1.Budding— how are vesicles formed? How can cargo proteins be selectively.
Lecture 11 Vesicular Trafficking: Lysosomes;
Vesicular Traffic II. Endocytic and secretory pathways red = secretory green = endocytic blue = recycling.
Lecture 16 Vesicle transport and targeting in the secretory pathway
Cytoplasmic Membrane Systems II Lecture 12. How Do Proteins Get Imported Into Membrane Enclosed Organelles? Import Requires Input of Energy to Occur!
Topic 41 4.Structure/Function of the Organelles - Synthesis.
Lecture 6 - Intracellular compartments and transport I.
Lecture 7 - Intracellular compartments and transport II
Lecture 3 Vesicular Trafficking -Cops and Clathrins -Arfs, Rabs, Sars -Snares.
Lecture 2: Protein sorting (endoplasmic reticulum) Dr. Mamoun Ahram Faculty of Medicine Second year, Second semester, Principles of Genetics.
Tour of the Cell
Extra credit for Midterm 2
Functions Site for concentrating and packing the materials in other parts of the cell e.g. proteins newly synthesized in the rough ER are transported.
Chapter 25 Protein trafficking Introduction 25.2 Oligosaccharides are added to proteins in the ER and Golgi 25.3 The Golgi stacks are polarized.
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting How are proteins targeted and delivered?
Summary 1.Rough ER and smooth ER; 2.Signal hypothesis, translocation into ER; 3.Single-span and multi-span membrane proteins; 4.Glycosylation; 5.Protein.
The Secretory Pathway Becky Dutch Molecular and Cellular Biochemistry 1. ER - translation 2. ER- protein modifications 3. Discussion Section 4. Golgi apparatus.
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting Proteins made in cytosol (cytosolic and.
Endocytosis & Exocytosis By : Matt Sargeant. What is Endocytosis and Exocytosis? Endocytosis is a process by which cells absorb molecules (such as proteins)
Molecular and Cellular Biochemistry 2. ER- protein modifications
TGN SNAP-23, syntaxin-3 (t) VAMP-7 (v) VAMP-8 (?) Annexin 13B MAL 17 Protein kinase D NSF,  -SNAP, syntaxin 4(?), SNAP 23, VAMP (toxin sensitive), cdc42.
Copyright © 2005 Pearson Prentice Hall, Inc. Intracellular Compartments and Transport Membrane Enclosed Organelles Protein Sorting Vesicular Transport.
CYTOLOGY & HISTOLOGY Lecture Four
ER and Golgi: Working Together! Mr. Nichols PHHS.
BIO201A Cell Biology Lecture 29 Wednesday 04/04/07.
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting How are proteins targeted and delivered?
1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT.
Copyright (c) by W. H. Freeman and Company 17.3 The rough ER is an extensive interconnected series of flattened sacs Figure
Vesicular Transport Pages The general flow of membrane enclosed material within cells.
Vesicular Trafficking Movement From the ER Through the Golgi.
MB207 Molecular Cell Biology Intracellular Vesicular Traffic Outline: Principles of vesicular traffic Transport from ER through Golgi Apparatus Transport.
Cytoplasmic membranes-1 Unit objective: To understand that materials in cell are shuttled from one part to another via an extensive membrane network.
Lecture 12: The secretory pathway
The ER and Golgi Modify & Sort Proteins
E NDOMEMBRANOUS S YSTEMS By; Ayesha Shaukat. Functions of Rough ER  Many types of cells secrete proteins produced by ribosomes attached to rough ER.
Intracellular Vesicular Traffic
Subcellular compartments that constitute the cellular endomembrane system. The major organelles of the endomembrane system are: the endoplasmic reticulum.
glycosylation is a non-template derived phenomenon
Protein Sorting & Transport
Vesicular Trafficking
Exocytosis, Endocytosis, Endosomes and Lysosome Formation
Subcellular compartments that constitute the cellular endomembrane system. The major organelles of the endomembrane system are: the endoplasmic reticulum.
The Endomembrane system
Vesicular transport Dr. med. habil. Kőhidai László Assoc. Professor
Intracellular Compartments and Transport 2
The Mechanisms of Vesicle Budding and Fusion
The Road Taken Cell Volume 100, Issue 1, Pages (January 2000)
structure & function of eukaryotic organelle
By: Waleedullah Jan BSc Human Biology
Intracellular Compartments and Transport
Membrane Dynamics in Endocytosis
Endocytic trafficking of CFTR in health and disease
Chapter 13 Intracellular Vesicular Traffic.
Neuronal Polarity and Trafficking
Intracellular Compartments and Vesicular Trafficking
Presentation transcript:

Protein trafficking between membranes By Graham Warren & Ira Mellman Chapter 4 Protein trafficking between membranes By Graham Warren & Ira Mellman

4.1 Introduction Eukaryotic cells have an elaborate system of internal membrane-bounded structures called organelles. Each organelle: has a unique composition of (glyco)proteins and (glyco)lipids carries out a particular set of functions

An organelle comprises one or more membrane-bounded compartments. 4.1 Introduction An organelle comprises one or more membrane-bounded compartments. Organelles may act autonomously or in cooperation to accomplish a given function. In the endocytic and exocytic pathways, cargo proteins are transferred between compartments by transport vesicles.

The vesicles form by budding from an organelle’s surface. 4.1 Introduction The vesicles form by budding from an organelle’s surface. They subsequently fuse with the target membrane of the acceptor compartment.

Transport vesicles can selectively: 4.1 Introduction Transport vesicles can selectively: include material destined for transfer exclude material that must remain in the organelle from which they bud Selective inclusion into transport vesicles is ensured by signals in a protein’s amino acid sequence or carbohydrate structures. Transport vesicles contain proteins that target them specifically to their intended destinations with which they dock and fuse.

4.2 Overview of the exocytic pathway All eukaryotes have the same complement of core exocytic compartments: the endoplasmic reticulum the compartments of the Golgi apparatus post-Golgi transport vesicles

Each organelle in the exocytic pathway has a specialized function. 4.2 Overview of the exocytic pathway The amount and organization of exocytic organelles varies from organism to organism and cell type to cell type. Each organelle in the exocytic pathway has a specialized function. The endoplasmic reticulum is the site for the synthesis and proper folding of proteins.

In the Golgi apparatus, proteins are: 4.2 Overview of the exocytic pathway In the Golgi apparatus, proteins are: Modified Sorted carried by the post-Golgi transport vesicles to the correct destination. Cargo transport to the plasma membrane occurs: directly by a constitutive process or indirectly by a regulated process. This involves temporary storage in secretory granules until the cell receives an appropriate stimulus.

4.3 Overview of the endocytic pathway Extracellular material can be taken into cells by several different mechanisms. The low pH and degradative enzymes in endosomes and lysosomes are important in processing some endocytosed material.

4.4 Concepts in vesicle-mediated protein transport Transport vesicles move proteins and other macromolecules from one membrane-bounded compartment to the next along the exocytic and endocytic pathways. Coats formed from cytoplasmic protein complexes help to: generate transport vesicles select proteins that need to be transported

4.4 Concepts in vesicle-mediated protein transport Proteins destined for transport to one compartment are sorted away from: resident proteins proteins that are destined for other compartments Transport vesicles use tethers and SNAREs to dock and fuse specifically with the next compartment on the pathway. Retrograde (backward) movement of transport vesicles carrying recycled or salvaged proteins compensates for anterograde (forward) movement of vesicles.

4.5 The concepts of signal-mediated and bulk flow protein transport Soluble secretory proteins, especially those secreted in large amounts, may not require specific signals to traverse the exocytic pathway.

4.5 The concepts of signal-mediated and bulk flow protein transport Sorting signals may be restricted to membrane proteins and endocytosed receptors; particularly those that are targeted to some intracellular destinations, such as lysosomes. Some soluble proteins have signals that allow them to interact with receptors that mediate their transport to lysosomes.

4.6 COPII-coated vesicles mediate transport from the ER to the Golgi apparatus COPII vesicles are the only known class of transport vesicles originating from the endoplasmic reticulum. Assembly of the COPII coat proteins at export sites in the endoplasmic reticulum requires a GTPase and structural proteins.

4.6 COPII-coated vesicles mediate transport from the ER to the Golgi apparatus Export signals for membrane proteins in the endoplasmic reticulum are usually in the cytoplasmic tail. After scission, COPII vesicles may cluster, fuse, and then move along microtubule tracks to the cis-side of the Golgi apparatus.

4.7 Resident proteins that escape from the ER are retrieved Abundant, soluble proteins of the endoplasmic reticulum (ER) contain sequences (such as KDEL or a related sequence). These sequences allow them to be retrieved from later compartments by the KDEL receptor.

4.7 Resident proteins that escape from the ER are retrieved Resident membrane proteins and cycling proteins are retrieved to the ER by a dibasic signal in the cytoplasmic tail. The ER retrieval signal for type I transmembrane proteins is a dilysine signal. Type II transmembrane proteins have a diarginine signal.

4.8 COPI-coated vesicles mediate retrograde transport from the Golgi apparatus to the ER COPI coat assembly is triggered by a membrane-bound GTPase called ARF.

4.8 COPI-coated vesicles mediate retrograde transport from the Golgi apparatus to the ER ARF recruits coatomer complexes, and disassembly follows GTP hydrolysis. COPI coats bind directly or indirectly to cargo proteins that are returned to the endoplasmic reticulum from the Golgi apparatus.

4.9 There are two popular models for forward transport through the Golgi apparatus Transport of large protein structures through the Golgi apparatus occurs by cisternal maturation. Individual proteins and small protein structures are transported through the Golgi apparatus either by cisternal maturation or vesicle-mediated transport.

4.10 Retention of proteins in the Golgi apparatus depends on the membrane-spanning domain The membrane-spanning domain and its flanking sequences are sufficient to retain proteins in the Golgi apparatus. The retention mechanism for Golgi proteins depends on the ability to form oligomeric complexes and the length of the membrane-spanning domain.

4.11 Rab GTPases and tethers are two types of proteins that regulate vesicle targeting Monomeric GTPases of the Sar/ARF family are involved in generating the coat that forms transport vesicles. Another family, the Rab GTPases, are involved in targeting these vesicles to their destination membranes.

4.11 Rab GTPases and tethers are two types of proteins that regulate vesicle targeting Different Rab family members are found at each step of vesicle-mediated transport. Proteins that are recruited or activated by Rabs (downstream effectors) include: tethering proteins such as long fibrous proteins large multiprotein complexes Tethering proteins link vesicles to membrane compartments and compartments to each other.

4.12 SNARE proteins likely mediate fusion of vesicles with target membranes SNARE proteins are both necessary and sufficient for specific membrane fusion in vitro, but other accessory proteins may be needed in vivo. A v-SNARE on the transport vesicle interacts with the cognate t-SNARE on the target membrane compartment.

4.12 SNARE proteins likely mediate fusion of vesicles with target membranes The interaction between v- and t-SNAREs is thought to bring the membranes close enough together so that they can fuse. After fusion: the ATPase NSF unravels the v- and t-SNAREs the v-SNAREs are recycled to the starting membrane compartment

4.13 Endocytosis is often mediated by clathrin-coated vesicles The stepwise assembly of clathrin triskelions may help provide the mechanical means to deform membranes into coated pits. Various adaptor complexes provide the means of selecting cargo for transport by binding both to: sorting signals clathrin triskelions

4.13 Endocytosis is often mediated by clathrin-coated vesicles GTPases of the dynamin family help release the coated vesicle from the membrane. Uncoating ATPases remove the clathrin coat before docking and fusion.

4.14 Adaptor complexes link clathrin and transmembrane cargo proteins Adaptor complexes bind to: the cytoplasmic tails of transmembrane cargo proteins clathrin Phospholipids Adaptors of the AP family are heterotetrameric complexes of two adaptin subunits and two smallerproteins.

4.14 Adaptor complexes link clathrin and transmembrane cargo proteins The AP adaptors bind to sorting signals in the cytoplasmic tails of cargo proteins. The best-characterized of these signals contain tyrosine or dileucine residues. Adaptor complexes allow for the selective and rapid internalization of receptors and their ligand.

4.15 Some receptors recycle from early endosomes whereas others are degraded in lysosomes Early endosomes are mildly acidic and lack degradative enzymes, so: internalized ligands can be dissociated without degradation of their receptors. Many receptors are recycled to the cell surface in transport vesicles that bud from the tubular extensions of early endosomes.

Receptors that are not recycled: 4.15 Some receptors recycle from early endosomes whereas others are degraded in lysosomes Dissociated ligands are transferred from early endosomes to the more acidic and hydrolase-rich late endosomes and lysosomes for degradation. Receptors that are not recycled: are segregated into vesicles within multivesicular bodies move to late endosomes and lysosomes for degradation

Recycling endosomes are found adjacent to the nucleus. 4.15 Some receptors recycle from early endosomes whereas others are degraded in lysosomes Recycling endosomes are found adjacent to the nucleus. They contain a pool of recycling receptors that can be transported rapidly to the cell surface when needed.

4.16 Early endosomes become late endosomes and lysosomes by maturation Movement of material from early endosomes to late endosomes and lysosomes occurs by “maturation.” A series of ESCRT protein complexes sorts proteins into vesicles that bud into the lumen of endosomes. This forms multivesicular bodies that facilitate the process of proteolytic degradation.

4.17 Sorting of lysosomal proteins occurs in the trans-Golgi network All newly synthesized membrane and secretory proteins share the same pathway up until the TGN. There they are sorted according to their destinations into different transport vesicles. Clathrin-coated vesicles transport lysosomal proteins from the trans-Golgi network to maturing endosomes.

4.17 Sorting of lysosomal proteins occurs in the trans-Golgi network In the Golgi apparatus, mannose 6-phosphate is covalently linked to soluble enzymes destined for lysosomes. The mannose 6-phosphate receptor delivers these enzymes from the trans-Golgi network to the endocytic pathway.

4.17 Sorting of lysosomal proteins occurs in the trans-Golgi network Lysosomal membrane proteins are transported from the trans-Golgi network to maturing endosomes. But, they use different signals than the soluble lysosomal enzymes.

4.18 Polarized epithelial cells transport proteins to apical and basolateral membranes The plasma membrane of a polarized cell has separate domains with distinct sets of proteins. This necessitates a further sorting step. Depending on the cell type, sorting of cell surface proteins in polarized cells can occur at: the TGN endosomes one of the plasma membrane domains Sorting in polarized cells is mediated by specialized adaptor complexes and perhaps lipid rafts and lectins.

4.19 Some cells store proteins for later secretion Some cargo molecules are stored in secretory granules, which: fuse with the plasma membrane release their contents only upon stimulation Storage of proteins for regulated secretion often involves a condensation process. Cargo self-associates, condensing to form a concentrated packet for eventual delivery to the outside of the cell.

Condensation of proteins for regulated secretion often 4.19 Some cells store proteins for later secretion Condensation of proteins for regulated secretion often begins in the endoplasmic reticulum continues in the Golgi apparatus is completed in condensing vacuoles that finally yield secretory granules Condensation is accompanied by selective membrane retrieval at all stages of exocytosis.

4.19 Some cells store proteins for later secretion Fusion of synaptic vesicles with the plasma membrane involves SNARE proteins. But it is regulated by calcium-sensitive proteins such as synaptotagmin.