Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center, Beillinson Campus Felsenstein Medical Research Center 8 March 2010

Historical perspective 1908, McClintock & Muller “Chromosome bore a special component at their ends that provided stability” Telomere: telos- end, meros- part 1961, Hayflick & Moorehead “Normal somatic cells have a limited life span- a status that is terminated in M1 stage- replicative senescence”. Leonard Hayflick

Biological landmarks 1971, Olovnikov: “Marginotomy”- the end-replication problem may account for the Hayflick limit 1972, Watson: DNA polymerase could not replicate chromosomes to the tip

The end-replication problem 5’ 3’ 3’ 5’ DNA Replication R R R R R RNA primer removal Fill-in DNA replication Ligation Each division 50-100 bp loss

Biological landmarks (cont.) 1978, Blackburn discovered telomeres in Tetrahymena (TTGGGG)n 1984, Blackburn & Greider telomerase activity was detected in

Telomeric end of DNA Genomic DNA Telomere

Molecular structure of the telomere

Functions of telomere [(TTAGGG)n] Protects the chromosomal ends from: Recombination End-to-end fusion Recognition as damaged DNA Enables a complete replication of the DNA Contributes to the functional organization of chromosomes in the nucleus Participates in regulation of gene expression Serves as “mitotic clock”: shortens with each cell division

Telomere length in healthy population Uziel et al. 2002

Consequences of telomere shortening & damage

Two-step hypothesis of cellular senescence and immortalization Two-step hypothesis of cellular senescence and immortalization Wright & Shay Microbiol Mol Biol Rev 2002

Telomerase Telomerase hTERT hTR-CAAUCCCAAUC 5’ TTAGGGTTAG CAAUCCCAAUC 5’ TTAGGGTTAGGGTTAG 5’ TTAGGGTTAGGGTTAGGGTTAG Telomerase hTERT hTR-CAAUCCCAAUC

Keeping telomerase in its place Maser & DePinho Nature Medicine 2002

The telomere model for cellular transformation Germ cells: telomerase ON Somatic cells: telomerase OFF Telomere length Immortal cells: telomerase ON Oncogenetically transformed cells: bypass senescence, telomerase OFF Senescence Crisis # of cell divisions

TRF measurements Shapiro, Uziel and Lahav 2000 Southern blot FISH flow

FISH on paraffin embedded tissues

Clinical applications of telomere research

Acquired capabilities of cancer (Hanahan and Weinberg, Cell 100: 57-70, 2000)

Minimal set of genetic alterations required for conversion of fibroblasts to cancer cells Sun et al 2006 Malignant conversion: SV40 large T antigen (p53 and pRb inactivation) Ras activation Malignant cells are not immortal - enter crisis and die Telomerase expression renders cell immortal

Telomerase up-regulation cause or consequence Human cancer cells have shorter telomeres then normal dysfunctional telomeres (anaphase bridges, ends fusions etc.,) Correlation between anaphase bridges and telomere length Human colorectal cancers show a peak in anaphase bridges index in early lesions;

Effect of telomerase inhibition on malignant cells growth

Telomerase inhibition in cancer Lahav 2010

Chemosensitization by telomeres Lahav 2009

Comet assay DNA damage Lahav 2010

DNA damage focci telomere dysfunction Lahav 2009

Association of telomerase activity with disease free survival in non-small cell lung cancer Gonzalez-Quevedo, R. et al. J Clin Oncol. 2002;20:254-262

Thalidomide downregulates telomerase promoter gene expression molecular pharmacology Druker, Uziel, Lahav et al. 2004 molec pharmacol ARH-77 hTERT IGFI-R CD63 b actin [ThD] mg/ml 0 12.5 25 50 100 RPMI 8226 U266 hTERT IGFI-R b actin CD63 [ThD] mg/ml 0 12.5 25 50 100 hTERT IGFI-R CD63 [ThD] mg/ml 0 12.5 25 50 100 b actin

Telomerase activity after Gleevec 5 days treatment Gleevec inhibits telomerase activity in SK-N-MC cells Uziel and Lahav,2005 BJC 0mM 10mM 15mM R8 Inhibition range: 70-90% Telomerase activity after Gleevec 5 days treatment 0 10 15 Kinetics of telomerase activity during Gleevec treatment

Telomerase cellular localization in STI571 treated cells Telomerase cellular localization in STI571 treated cells Uziel, Beery et al 2003 Control cells STI571 treated cells

Telomerase as a drug target Significant difference of telomerase expression between malignant and normal tissues Possible adverse effects: damage to stem and germ cells Telomerase inhibitors will be effective only when the telomeres shorten to critical length Will probably be used as an adjuvant therapy

Potential effects of telomerase inhibition over time on telomere length and proliferative capacity Experts reviews in molecular medicine 2002

Strategies for inhibition of telomerase activity Telomerase targeting agents: The RNA template Reverse transcriptase inhibitors Modulators of telomerase regulating proteins Telomeres targeting agents Inhibitors that interact with G4-DNA structures Inhibitors against telomeres associated proteins “Old” DNA -interacting drugs compounds from random screening

Effect of telomerase antisense on malignant cell culture Uziel and Lahav, 2004

Antimetastatic effects of GRN163L on pretreated A549-Luc cells Dikmen, Z. G. et al. Cancer Res 2005;65:7866-7873

Telomere attrition sensitize SK-N-MC cells to DNA SS breaks inducing agent, Cisplatinum Uziel and Lahav, 2006 Control +GRN163

Telomerase inhibition – future directions New effective inhibitors Antitelomerase vaccines Antitelomerase adoptive immunotherapy Promoter driven therapy Development of antitelomerase – cytotoxic drugs – other biologic interventions combinations

Telomerase promoter-driven gene therapy hTERT promoter is highly active in cancer cells (not active in somatic cells) Expression of harmful genes under the control of hTERT promoter- expression directed to malignant cells Genes used Proapoptotic genes: caspase 8, caspase 6, TRAIL, Bax Prodrugs Viral lytic genes: adenoviruses

Adenovirus and telomerase promoter

Telomerase immunotherapy Immunizing patients against tumor antigens to elicit antibody or cytotoxic T-cells killing of tumor cells T cells against a short hTERT peptide in vitro and in mouse models in vivo; Somatic cells are not affected Prostate or breast cancer patients were vaccinated with cells expressing tert peptide; 4 responded; No se. 12 prostate cancer patients were treated as above, majority responded positively

Aging Aging

Comparison between a single homologue from one individual and a single homologue from an unrelated individual carrying the same genetic marker

Dolly or failure of resetting the cellular clock Willmut et al, 1997

Telomere length & survival rate

Trans-differentiation of pluripotent stem cells

Telomerase effect on cells

Telomere binding defect in progeria

Diabetes control and telomeres Lahav 2006

Translational applications ; Cancer; Mechanism of malignancy Therapeutic approaches Aging; Cellular ( stem cells) Organism ; normal accelerated aging