Bioinformatics BIO520 Chuck Staben Tom Badgett. Louis XV After me, the deluge.

Slides:



Advertisements
Similar presentations
Fossils provide a record of evolution.
Advertisements

LESSON 1: What is Genetic Research? PowerPoint slides to accompany Using Bioinformatics : Genetic Research.
BCH364C/391L Systems Biology/Bioinformatics (course # 54995/55095) Spring 2015 Tues/Thurs 11 – 12:30 PM BUR 212 Edward Marcotte/Univ. of Texas/BCH391L/Spring.
Presentation to Educational Policy Committee Department of Biology Revised March, 2013 Biology Department: Position Requests.
Study Guide 1.1 Answers should include different land and aquatic environments, as well as the atmosphere. the variety of life on Earth a type of living.
August 19, 2002Slide 1 Bioinformatics at Virginia Tech David Bevan (BCHM) Lenwood S. Heath (CS) Ruth Grene (PPWS) Layne Watson (CS) Chris North (CS) Naren.
Bioinformatics David Brodin BEA core facility MOLEKYLÄRBIOLOGI MED GENETIK – BIOINFORMATIK HT -07 Course web page:
AP Biology Teaching Biology Through Bioinformatics Real world genomics research in your classroom Kim B. Foglia Division Ave. High School Levittown.
27803::Systems Biology1CBS, Department of Systems Biology Schedule for the Afternoon 13:00 – 13:30ChIP-chip lecture 13:30 – 14:30Exercise 14:30 – 14:45Break.
Computational Molecular Biology (Spring’03) Chitta Baral Professor of Computer Science & Engg.
Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.
ONCOMINE: A Bioinformatics Infrastructure for Cancer Genomics
Bioinformatics Lecture 2. Bioinformatics: is the computational branch of molecular biology Using the computer software to analyze biological data The.
What is Biology? The science of living organisms and life processes, including the study of structure, functioning, growth, origin, evolution and distribution.
What is Biology? The science of living organisms and life processes, including the study of structure, functioning, growth, origin, evolution and distribution.
1 Welcome to Biol 178 Principles of Biology Course goals Course information Text Grading Syllabus Lab Chapter Organization.
Bio/CS 251 Introduction to Bioinformatics. Class Web Site This site will contain all important documents.
Biology 107 General Biology Pat Akrabawi Michael Cullen Brian Ernsting.
Algorithms in Computational Biology Tanya Berger-Wolf Compbio.cs.uic.edu/~tanya/teaching/CompBio January 13, 2006.
Welcome to Biol 178 Principles of Biology Course goals Course information Text Grading Syllabus Lab Chapter Organization.
BIO337 Systems Biology/Bioinformatics (course # 50524) Spring 2014 Tues/Thurs 11 – 12:30 PM BUR 212 Edward Marcotte/Univ. of Texas/BIO337/Spring 2014.
Bioinformatics Jan Taylor. A bit about me Biochemistry and Molecular Biology Computer Science, Computational Biology Multivariate statistics Machine learning.
9/30/2004TCSS588A Isabelle Bichindaritz1 Introduction to Bioinformatics.
Metagenomic Analysis Using MEGAN4
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
Master’s Degrees in Bioinformatics in Switzerland: Past, present and near future Patricia M. Palagi Swiss Institute of Bioinformatics.
Introduction to Bioinformatics Spring 2002 Adapted from Irit Orr Course at WIS.
Finish up array applications Move on to proteomics Protein microarrays.
 SC235: Unit 1 Seminar Is it Biotic?. Course Overview  Term: Feb. 2 nd – April 12 th  Course site  Doc sharing  Webliography  Drop box  Communication:
Intelligent systems in bioinformatics Introduction to the course.
What is Genetic Research?. Genetic Research Deals with Inherited Traits DNA Isolation Use bioinformatics to Research differences in DNA Genetic researchers.
Genomics for Librarians Stuart M. Brown, Ph.D. Director, Research Computing, NYU School of Medicine.
Overview of Bioinformatics 1 Module Denis Manley..
INTRODUCTION TO PLANT MOLECULAR GENETICS. Genetics The study of heredity The study of heredity The study of how differences between individuals are transmitted.
BIOLOGICAL DATABASES. BIOLOGICAL DATA Bioinformatics is the science of Storing, Extracting, Organizing, Analyzing, and Interpreting information in biological.
IPlant Genomics in Education
Data Mining and Decision Trees 1.Data Mining and Biological Information 2.Data Mining and Machine Learning Techniques 3.Decision trees and C5 4.Applications.
Studying Life “Biology” BIO 137 – Ch. 1. Biology- using the scientific method to study living organisms; the study of life; the study of the living world.
Bioinformatics and Computational Biology
An approach to carry out research and teaching in Bioinformatics in remote areas Alok Bhattacharya Centre for Computational Biology & Bioinformatics JAWAHARLAL.
Overview of Bioinformatics Module Denis Manley.. Contact Details Lecturer Name: Denis Manley Room number: KE-1-013a
Mr. Ulmer Modern Biology: The Study of Life. The Class Web Site WEB WEB There is a 150 page class web site. There is a 150 page class web site. It is.
The Future of Genetics Research Lesson 7. Human Genome Project 13 year project to sequence human genome and other species (fruit fly, mice yeast, nematodes,
Bioinformatics Dipl. Ing. (FH) Patrick Grossmann
Chapter 1 Principles of Life
Biotechnology and Bioinformatics: Bioinformatics Essential Idea: Bioinformatics is the use of computers to analyze sequence data in biological research.
Chapter 1 Principles of Life. All organisms Are composed of a common set of chemical components. Genetic information that uses a nearly universal code.
STAT115 STAT215 BIO512 BIST298 Introduction to Computational Biology and Bioinformatics Spring 2016 Xiaole Shirley Liu.
BME435 BIOINFORMATICS.
Biological Databases By: Komal Arora.
Genomics A Systematic Study of the Locations, Functions and Interactions of Many Genes at Once.
Themes of Biology Chapter 1
Lecture 2.1.
Bioinformatics Madina Bazarova. What is Bioinformatics? Bioinformatics is marriage between biology and computer. It is the use of computers for the acquisition,
Overview Bioinformatics: Analyzing biological data using statistics, math modeling, and computer science BLAST = Basic Local Alignment Search Tool Input.
Genome organization and Bioinformatics
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
9 Future Challenges for Bioinformatics
Lecture 7: Biological Network Crosstalk Y. Z
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Schedule for the Afternoon
The Study of Biological Information
Introduction to Bioinformatic
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
INTRODUCTION TO MOLECULAR GENETICS
Introduction to Bioinformatics
Introduction to Bioinformatics
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Presentation transcript:

Bioinformatics BIO520 Chuck Staben Tom Badgett

Louis XV After me, the deluge

Bioinformatics-what is it? Acquisition, curation, and analysis of biological data Hypothesis

Bioinformatics training Who needs it? Life Scientists –Professional –Graduate –Undergraduate Medical professionals –Pre-med undergrads Information scientists –Computer scientists –Library/database specialists Statisticians Mathematicians

BIO520 Syllabus Content –Lectures –Lab Exercises: sessions or NetMeetings –Reading – –UKTV (16): Sat, Sun 4-5 PM Expectations Grading –Assignments, Hour Exam, Project

Class Project Fermentation-Respiration Shift in Yeast Transcription analysis –Control sequences Transcription/Translation/Metabolism Correlation Evolutionary Conservation Applications to Drug Discovery

Computer Resources WWW materials – –listserv: –newsgroup: news.uky.edu/uky.classes.bio520 –NetMeeting SeqWeb – Seqanal –seqanal.mi.uky.edu (telnet)

Information Science Dramatic Changes Information Storage –Digitized databases: text, numbers, images Computerized Analysis –Facile Information Distribution –WWW, ,...

Bioinformatic Data-1978 to 1998 DNA sequence Gene expression Protein expression Protein Structure Genome mapping Metabolic networks Regulatory networks Trait mapping Gene function analysis Scientific Literature

DNA Sequence

Transcript Analyses Northern Blot-1977Genomic transcript profiling DeRisi, Iyer, Brown; Science, 1998

Protein Structure Determination

Genome/Trait Maps

Protein Expression Analysis

Metabolic Networks KEGG, 1998

Regulatory Networks KEGG

Bioinformatic Challenges Acquire, store, share, search data Analyze data Interpret analyses Design further analyses to produce high-value information Apply results of analyses

Biological Principles Structure  Function Homeostasis Evolution by natural selection

Biological Hierarchies Molecule Cell Tissue Organ Organism Population Species Biosphere