Structural, functional Genome, Transcriptome, Proteome, Metabolome, Interactome www.the-scientist.com Genomics.

Slides:



Advertisements
Similar presentations
Lecture 2 Strachan and Read Chapter 13
Advertisements

Applications of genome sequencing projects 1) Molecular Medicine 2) Energy sources and environmental applications 3) Risk assessment 4) Bioarchaeology,
applications of genome sequencing projects
Identification of markers linked to Selenium tolerance genes
Single Strand Conformational Polymorphism (SSCP)
Molecular Markers.
DNA polymorphisms Insertion-deletion length polymorphism – INDEL Single nucleotide polymorphism – SNP Simple sequence repeat length polymorphism – mini-
DNA fingerprinting Every human carries a unique set of genes (except twins!) The order of the base pairs in the sequence of every human varies In a single.
Mining SNPs from EST Databases Picoult-Newberg et al. (1999)
Generation and Analysis of AFLP Data
16 and 20 February, 2004 Chapter 9 Genomics Mapping and characterizing whole genomes.
SSR.
Genomes summary 1.>930 bacterial genomes sequenced. 2.Circular. Genes densely packed Mbases, ,000 genes 4.Genomes of >200 eukaryotes (45.
PLANT BIOTECHNOLOGY & GENETIC ENGINEERING (3 CREDIT HOURS)
RFLP DNA molecular testing and DNA Typing
DNA AMPLIFICATION MARKERS -RAPD -SSR/ISSR -FISH-DNA
Today’s Lecture Genetic mapping studies: two approaches
Paras Yadav 1, Aarti Bhardwaj 3, Shalini Jain 2 and Hariom Yadav 2 1 Animal Biotechnology Division, National Dairy Research Institute, Karnal , Haryana,
Reading the Blueprint of Life
Chapter 5: Hybridisation & applications
Plant Molecular Systematics Michael G. Simpson
HAPLOID GENOME SIZES (DNA PER HAPLOID CELL) Size rangeExample speciesEx. Size BACTERIA1-10 Mb E. coli: Mb FUNGI10-40 Mb S. cerevisiae 13 Mb INSECTS.
Using mutants to clone genes Objectives 1. What is positional cloning? 2.What is insertional tagging? 3.How can one confirm that the gene cloned is the.
DNA Fingerprinting A method for the detection of DNA variation PBG/MCB 620 DNA Fingerprinting image source -
PLANT GENETIC MARKERS Plant Biotechnology Dr.Ir. Sukendah, MSc.
Fig Chapter 12: Genomics. Genomics: the study of whole-genome structure, organization, and function Structural genomics: the physical genome; whole.
Module 1 Section 1.3 DNA Technology
20.1 Structural Genomics Determines the DNA Sequences of Entire Genomes The ultimate goal of genomic research: determining the ordered nucleotide sequences.
APPLICATION OF MOLECULAR MARKERS FOR CHARACTERIZATION OF LATVIAN CROP PLANTS Nils Rostoks University of Latvia Vienošanās Nr. 2009/0218/1DP/ /09/APIA/VIAA/099.
Chapter 6 PCR and in vitro Mutagenesis A. Basic features of PCR 1. PCR is a cell-free method of DNA cloning standard PCR reaction is a selective DNA amplification.
Molecular identification of living things. Molecular Markers Single locus marker Multi-locus marker RFLP Microsatellite DNA Fingerprinting AFLP RAPD.
1 Gene Therapy Gene therapy: the attempt to cure an underlying genetic problem by insertion of a correct copy of a gene. –Tantalizingly simple and profound.
19.1 Techniques of Molecular Genetics Have Revolutionized Biology
Used for detection of genetic diseases, forensics, paternity, evolutionary links Based on the characteristics of mammalian DNA Eukaryotic genome 1000x.
Studijní obor Bioinformatika. LAST LECTURE SUMMARY.
Linkage and Mapping. Figure 4-8 For linked genes, recombinant frequencies are less than 50 percent.
Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.
Chapter 5 The Content of the Genome 5.1 Introduction genome – The complete set of sequences in the genetic material of an organism. –It includes the.
ABC for the AEA Basic biological concepts for genetic epidemiology Martin Kennedy Department of Pathology Christchurch School of Medicine.
1 DNA Polymorphisms: DNA markers a useful tool in biotechnology Any section of DNA that varies among individuals in a population, “many forms”. Examples.
Lecture 6. Functional Genomics: DNA microarrays and re-sequencing individual genomes by hybridization.
Lecture 2: Biology Review II
February 20, 2002 UD, Newark, DE SNPs, Haplotypes, Alleles.
Molecular Basis for Relationship between Genotype and Phenotype DNA RNA protein genotype function organism phenotype DNA sequence amino acid sequence transcription.

In The Name of GOD Genetic Polymorphism M.Dianatpour MLD,PHD.
RFLP ((Restriction Fragment Length Polymorphism)
CASE7——RAD-seq for Grape genetic map construction
Simple-Sequence Length Polymorphisms SSLPs Short tandemly repeated DNA sequences that are present in variable copy numbers at a given locus. Scattered.
Molecular Basis for Relationship between Genotype and Phenotype DNA RNA protein genotype function organism phenotype DNA sequence amino acid sequence transcription.
Plant Breeding Shree Krishna Adhikari ©Shree Krishna Adhikari.
Gene Technologies and Human ApplicationsSection 3 Section 3: Gene Technologies in Detail Preview Bellringer Key Ideas Basic Tools for Genetic Manipulation.
Structural, functional Genome, Transcriptome, Proteome, Metabolome, Interactome Genomics.
Synteny - many distantly related species have co- linear maps for portions of their genomes; co-linearity between maize and sorghum, between maize and.
Restriction Fragment Length Polymorphism. Definition The variation in the length of DNA fragments produced by a restriction endonuclease that cuts at.
Arun Kumar. B M.Sc 1st Year Biotechnology SSBS
Simple-Sequence Length Polymorphisms
Molecular Markers Using DNA polymorphisms in plant breeding
GENETIC MARKERS (RFLP, AFLP, RAPD, MICROSATELLITES, MINISATELLITES)
Molecular Marker Characterization of plant genotypes
DNA Marker Lecture 10 BY Ms. Shumaila Azam
Relationship between Genotype and Phenotype
Relationship between Genotype and Phenotype
Relationship between Genotype and Phenotype
Applied Molecular Genetics Molecular Marker and Technique
Sequential Steps in Genome Mapping
Restriction Fragment Length Polymorphism (RFLP)
9-3 DNA Typing with Tandem Repeats
Relationship between Genotype and Phenotype
Forensic DNA Sadeq Kaabi
Presentation transcript:

Structural, functional Genome, Transcriptome, Proteome, Metabolome, Interactome Genomics

“ What's the Difference? Well, as a rule, genetics is the study of single genes in isolation. Genomics is the study of all the genes in the genome and the interactions among them and their environment(s). Analogy 1 If genomics is like a garden, genetics is like a single plant. If the plant isn’t flowering, you could study the plant itself (genetics) or look at the surroundings to see if it is too crowded or shady (genomics) – both approaches are probably needed to find out how to make your plant blossom.” Genomics or Genetics?

Structural genomics for plant breeders and applied geneticists = molecular markers How many genes determine important traits? Where these genes are located? How do the genes interact? What is the role of the environment in the phenotype? Molecular breeding: Gene discovery, characterization, and selection using molecular tools Molecular markers are a key implement in the molecular breeding toolkit Genomics and Molecular Markers

Markers are based on polymorphisms Amplified fragment length polymorphism Restriction fragment length polymorphism Single nucleotide polymorphism The polymorphisms become the alleles at marker loci The marker locus is not necessarily a gene: the polymorphism may be in the dark matter, in a UTR, in an intron, or in an exon Non-coding regions may be more polymorphic What is a Molecular Marker

Changes in the nucleotide sequence of genomic DNA that can be transmitted to the descendants. If these changes occur in the sequence of a gene, it is called a mutant allele. The most frequent allele is called the wild type. A DNA sequence is polymorphic if there is variation among the individuals of the population. DNA Mutations & Polymorphisms

5’ – AGCTGAACTCGACCTCGCGATCCGTAGTTAGACTAG -3’ Wildtype 5’ – AGCTGAACTCGGCCTCGCGATCCGTAGTTAGACTAG -3’ Substitution (transition: A G 5’ – AGCTCAACTCGACCTCGCGATCCGTAGTTAGACTAG -3’ Substitution (transversion: G C) 5’ – AGCTAACTCGACCTCGCGATCCGTAGTTAGACTAG -3’ Deletion (single bp) C 5’ – AGCTTCGCGATCCGTAGTTAGACTAG -3’ Deletion (DNA segment) CAACTCGACC Types of DNA Mutations (1)

5’ – AGCTGAACTCGACCTCGCGATCCGTAGTTAGACTAG - 3’ Wildtype 5’ – AGCTGAACTACGACCTCGCGATCCGTAGTTAGACTAG - 3’ Insertion (single bp) 5’ – AGCTGAACTAGTCTGCCCGACCTCGCGATCCGTAGTTAGACTAG -3’ Insertion (DNA segment) 5’ – AGCAGTTGACGACCTCGCGATCCGTAGTTAGACTAG -3’ Inversion Tranposition:5’ – AGCTCGACCTCGCGATCCGTAGTTATGAACGACTAG - 3’ Types of DNA Mutation (2)

A way of dealing with the Large number of genes per genome Huge genome size Technical challenges and cost of whole genome sequencing The search for DNA polymorphisms was not driven by a desire to complicate things, but rather by the low number of naked eye polymorphisms (NEPs) Markers may be linked to target genes Markers in target genes are perfect markers What is a perfect marker for a gene deletion? Why Use Markers?

Polymorphisms can be visualized at the metabolome, proteome, or transcriptome level but for a number of reasons (both technical and biological) DNA-level polymorphisms are currently the most targeted Regardless of whether it is a “perfect” or a “linked” DNA marker, there are two key considerations that need to be addressed in order for the researcher/user to visualize the underlying genetic polymorphism Applications in Mapping and Marker Assisted Breeding DNA Markers

1.Finding and understanding the genetic basis of the DNA-level polymorphism, which may be as small as a single nucleotide polymorphism (SNP) or as large as an insertion/deletion (INDEL) of thousands of nucleotides 2.Detecting the polymorphism via a specific assay or "platform". The same DNA polymorphism may be amenable to different detection assays Key steps for DNA Markers

1.Establish evolutionary relations: homoeology, synteny and orthology Homoeology: Chromosomes, or chromosome segments, that are similar in terms of the order and function of the genetic loci.  Homoeologous chromosomes may occur within a single allopolyploid individual (e.g. the A, B, and D genomes in wheat)  May also be found in related species (e.g. the 1A, 1B, 1D series of wheat and the 1H of barley) Orthology: Refers to genes in different species which are so similar in sequence that they are assumed to have originated from a single ancestral gene. Synteny:  Classically refers to linked genes on same chromosome  Also used to refer to conservation of gene order across species 2.Associations due to linkage or pleiotropy Identify markers that can be used in marker assisted selection 3.Locate genes for qualitative and quantitative traits Map-based cloning strategies Applications of Marker Maps

Polymorphisms vs. assays An ever-increasing number of technology platforms have been, and are being, developed to deal with these two key considerations These platforms lead to a bewildering array of acronyms for different types of molecular markers. To add to the complexity, the same type of marker may be assayed on a variety of platforms Ideal marker is one that targets the causal polymorphism (perfect marker). Not always available though….. Polymorphism Detection Issues

Labeled 3’ TGGCTAGCT 5’ Probe 3’ TGGCTAGCT 5’ ||||||||| Target 1 5’-CCTAACCGATCGACTGAC-3’ 2 5’-GGATTGGCTAGCTGACTG-3’ Restriction Fragment Length Polymorphism (RFLP) RFLPs (Botstein et al. 1980) are differences in restriction fragment lengths caused by a SNP or INDEL that create or abolish restriction endonuclease recognition sites. RFLP assays are based on hybridization of a labeled DNA probe to a Southern blot (Southern 1975) of DNA digested with a restriction endonuclease

RFLP Steps

Allele A Allele a AaaaAAaaA Ind 1 Ind 2Ind 5Ind 3Ind 4Ind 8Ind 6Ind 7 Co-Dominant RFLP Polymorphism Restriction Site

Allele A Allele a AaaaAAaaA Ind 1 Ind 2Ind 5Ind 3Ind 4Ind 8Ind 6Ind 7 Dominant RFLP Polymorphisms Restriction Site

Features of RFLPs Co-dominant, unless probe contains restriction site Locus-specific Genes can be mapped directly Supply of probes and markers is unlimited Highly reproducible Requires no special instrumentation Radioactive detection……

Amplified Fragment Length Polymorphism (AFLP) Fragment genomic DNA with frequent and rare cutters AFLPs (Vos et al. 1995) are differences in restriction fragment lengths caused by SNPs or INDELs that create or abolish restriction endonuclease recognition sites. AFLP assays are performed by selectively amplifying a pool of restriction fragments using PCR.

Digestion with 2 restriction enzymes EcoRI (1/4096) MseI (1/256) Restriction site adapter ligation T A T A 5’ 3’ 5’ 3’ Selective preamplification C T T A T G 5’ 3’ 5’ 3’ Amplification AFLP Protocol

AFLP Polymorphisms Polymorphisms between genotypes may arise from: –Sequence variation in one or both restriction sites –Sequence variation in the region immediately adjacent to the restriction sites –Insertions or deletions within an amplified fragment Band Detection –Denaturing polyacrylamide gel electrophoresis & autoradiography or silver staining –Sequencing

Features of AFLPs Very high multiplex ratio Very high throughput Off-the-shelf technology Fairly reproducible Dominant and co-dominant Radioactive detection but less hazardous options available Can convert favourite marker to SCAR

Simple Sequence Repeats (SSR) SSRs or microsatellites (Nakamura et al. 1987) are tandemly repeated mono-, di-, tri-, tetra-, penta-, and hexa-nucleotide motifs SSR length polymorphisms are caused by differences in the number of repeats Assayed by PCR amplification using pairs of oligonucleotide primers specific to unique sequences flanking the SSR Detection by autoradiography, silver staining, sequencing…

Repeat Motifs AC repeats tend to be more abundant than other di-nucleotide repeat motifs in animals (Beckmann and Weber 1992) The most abundant di-nucleotide repeat motifs in plants, in descending order, are AT, AG, and AC (Lagercrantz et al. 1993; Morgante and Oliveri 1993) Typically, SSRs are developed for di-, tri-, and tetra-nucleotide repeat motifs CA and GA have been widely used in plants Tetra-nucleotide repeats have the potential to be very highly polymorphic; however, many are difficult to amplify SSR Repeats

Simple sequence repeat in hazelnut Note the difference in repeat length AND the consistent flanking sequence

Individual 1 (AC)x9 Individual 2 (AC)x11 51 bp 55 bp Powell et al Proc Natl Acad Sci U S A. 92(17): 7759–7763. Chloroplast SSRs of pine SSR Protocol

Features of SSRs Highly polymorphic Highly abundant and randomly dispersed Co-dominant Locus-specific High throughput Can be automated

Diversity Arrays Technology - DArT

2,500 markers per sample 94 samples - ~$4,500 ~ 2 cents per datapoint DArT Analysis

Features of DArT Very high multiplex ratio Very high throughput Bi-allelic Dominant marker system Requires substantial investment Fairly reproducible DArT sequences now available

DNA sequence variations that occur when a single nucleotide (A, T, C, or G) in the genome sequence is altered Single Nucleotide Polymorphisms (SNP) Alleles …..ATGCTCTTACTGCTAGCGC…… …..ATGCTCTTCCTGCTAGCGC…… …..ATGCTCTTACTGCAAGCGC…… Single Nucleotide Polymorphisms (SNPs) Consensus…..ATGCTCTTNCTGCNAGCGC……

Features of SNP Highly abundant (1 every 200 bp in barley; Rostoks et al., 2005) Locus-specific Co-dominant and bi-allelic Basis for high-throughput and massively parallel genotyping technologies Genic rather than anonymous marker Phenotype due to SNP can be mapped directly

SNPS in Allopolyploids

Varietal SNPs in Allopolyploids

SNP Detection Strategy Locus specific system –Many samples with few markers Marker assisted selection in commercial breeding programmes for key target characters Addition of characteristic major genes to e.g. mapping populations and association panels KASP – buy master mix and synthesise own primers Genome wide system –Fewer samples with many markers Germplasm characterization, academic and breeding Genotyping panels for GWAS Illumina or Affymetrix for higher density arrays, costs↓ What about bi-parental populations??

Affymetrix Axiom Technology Two colour ligation based assay Utilises unique oligonucleotide complementary to flanking genomic sequence Automated parallel processing

Wheat SNP Arrays

KASP TM Genotyping More Information: /genotyping/#.VCMgyPldWJ0

Wheat SNP Resources

Wheat SNP Haplotypes

Sequencing Approaches RRL – Reduced Representation Library RAD-Seq – Restriction Site Associated DNA Sequencing GBS – Genotyping by Sequencing See Davey et al., (2011) Nature Reviews Genetics 12:

RADseq: Restriction-site Associated DNA markers Uses Illumina sequencing technology Based on digestion with restriction enzymes. An adapter binds to the restriction site and up to 5kb fragments are sequenced around the target size. Bioinformatics work used to find SNPs on the amplified regions

Genotyping by Sequencing

GP x Morex map

SNPs vs GbS SNPs –Minimal input, don’t even have to isolate DNA –Rapid turn around and data is ready to use –Markers in known genes and generally mapped –More useful in GWAS GbS –Now quite cheap and potentially many markers –Rapid generation of sequence output but markers are anonymous Find an expert bio-informatician to align your data and, if possible, align to reference sequence –More useful in bi-parental mapping studies

Marker to Candidate Gene