HAPPY TUESDAY Bellwork: Study the Central Dogma, Transcription, & Translation. On Bellwork sheet write “Study for Quiz”.

Slides:



Advertisements
Similar presentations
Chapter 13.3 (Pgs ): Mutations
Advertisements

Bellwork: Using the codon charts in your notes, fill in the boxes below. **Remember to use mRNA when doing translation**
Essential Question: What is a mutation?
Recall that with a GENE mutation, only one gene on the chromosome is affected. However, many genes are crucial for producing key enzymes and for controlling.
HAPPY WEDNESDAY Bellwork Quickwrite: In 27 words, Which would more likely have a bigger effect on an organism, a point mutation or frameshift mutation?
DNA MUTATIONS.
Mutations Mutation- a change in the DNA nucleotide sequence
By: Diana Olalde (DNA Mutations).  DNA is constantly subject to mutations, accidental changes in its code. Mutations can lead to missing or malformed.
Mutations. DNA Mistakes DNA is a molecule that replicates, works and copies with very high accuracy DNA has enzymes that make sure that it works with.
Definition : Any change in the nucleotide sequence of DNA.
Happy Tuesday! Bellwork: October 28 Write the following question and your answers on a bellwork page. In what organelle does transcription occur in the.
Ch Mutations Section Objectives:
-(6 th Period)Have out your Notecard Sticker Sheet. Lay out your notecards (definition side up) on your desk 6x5 “Allele” needs to be top left card. -For.
13-3 Mutations Can be good, bad or nothing!!. What is a mutation? The word is Latin for “to change”. There are 2 types: – 1) Single gene changes – 2)
Mutations. A Mutation is a change in an organism’s DNA  It can occur naturally whenever a base is incorrectly copied, especially during DNA Replication.
BELL WORK: You have five minutes to finish yesterday’s worksheets and turn them in.
Mutations in DNA changes in the DNA sequence that can be inherited can have negative effects (a faulty gene for a trans- membrane protein leads to cystic.
Genes in Action Chapter 14. Sex Linked Traits Another way for traits to be passed on is by being sex linked Female Chromosomes: XX Male Chromosomes: Xy.
Bell Work tRNA’s anticodons are complementary to mRNA’s codons when they meet in the ribosome, why is it important that they are the exact complement?
Happy Monday! Bellwork: October 26 Write the following question and your answers on a bellwork page. In what organelle does transcription occur in the.
MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.
 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.
Welcome 1/26-27/16  In your journal, write a paragraph explain what a genetic code is and the purpose of transcription and translation.  Turn in Snork.
12.4 Mutations Copyright Pearson Prentice Hall.. What Are Mutations? Changes in the nucleotide sequence of DNA (genetic material) May occur in somatic.

GENETIC MUTATIONS What is this picture depicting?.
Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)
Bellwork: ***STUDY FOR VOCAB 4 QUIZ*** Using the codon charts in your notes, fill in the boxes below. **Remember to use mRNA when doing translation**
Mutations and Genetic Disorders. Review One Wrong Letter Questions to think about: 1) How is the little boy in the video.
 BUILD-A-BUG ACTIVITY  Build your bug and turn in to your box  Mutations Notes  Mutations practice QUIZ NEXT CLASS: Transcription and Translation TUESDAY.
Central Dogma of Molecular Biology Genetic information flows in one direction – from DNA to RNA to proteins.
A change in the nucleotide sequence of DNA Ultimate source of genetic diversity Gene vs. Chromosome.
Mutations.
12.4 Assessment Answers.
Gene Mutations.
A B C HAVE NOTECARDS OUT IN A STACK Transcription Replication
Mutations.
aspartate / aspartic acid
DNA MUTATIONS.
Mutations.
Types of Mutations.
Copyright Pearson Prentice Hall
Mutations (Ch 13.3).
Gene Mutations.
MUTATIONS.
Genetic Mutations.
Mutations.
Lecture 3.
Mutations LN #23 Ms. Garcia California Content Standard Genetics
Types of point mutations
Mutations changes in the DNA sequence that can be inherited
Mutations.
Chapter 11.6 When it all goes Wrong
Mutations Section 12-4.
Mutations Any change in an organism’s DNA. Mutations in somatic cells only impact individual; mutations in gametes may impact offspring. 2 Types: A. Gene.
Mutations.
Mutations.
Mutations Ms MacCormack Fall 2018.
MUTATIONS.
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Mutations changes in genetic material (_____).
Mutations.
Draw a conclusion from this graph for both the red and blue line
MUTATIONS.
Read the lab handout COMPLETELY
Mutation Notes.
Unit 1 Human Cells Higher Human Biology for CfE Miss Aitken
Presentation transcript:

HAPPY TUESDAY Bellwork: Study the Central Dogma, Transcription, & Translation. On Bellwork sheet write “Study for Quiz”.

Standard: identify and illustrate changes in DNA (B.6E) Essential Question: How can I identify changes in DNA?

Think about it: What happens if our DNA gets messed up?

Mutations: changes in genetic material May be caused by: mistakes in DNA replication mistakes in transcription environmental factors (like radiation)

Point mutation: involves a change in a single base called substitution three types: silent: results in no change to the protein missense: results in one wrong amino acid nonsense: results in an early stop Which type of point mutation is this?

Types of Mutations

Frameshift mutation: involves a change that affects the entire amino acid sequence three types: insertion: an extra base is added deletion: a base is subtracted duplication: an entire codon is repeated

Genetic Mutations: Your Name 1.Copy the chart below. 2.Write your name in the first box. 3.Put a box around each codon. 4.Fill in the rest of the start by doing the mutation. 5.Put a box around each codon after the mutation. Name:E N R I Q U EGA R Z A Point(add a base into the sequence)E N R I Q U EGA R Z K Deletion (take a base away) E N R I U E GA R Z K Insertion(add a base)E X N R I U E GA R Z K

Think-Pair-Share Which would more likely have a bigger effect on an organism, a point mutation or frameshift mutation? Why?

mutation point frameshift protein frameshiftmutation pointprotein

Quickwrite Answer the following question in your journal (29 words): – If you have a mutation in a body cell (skin, stomach, bone, etc.), can you pass that mutation on to your children? Why or why not?

Do you know of any diseases caused by genetic mutations?

Sickle Cell Anemia These are the sickle-shaped blood cells of someone with sickle cell anemia. Sickle cell anemia is the result of a point mutation, a change in just one nucleotide in the gene for hemoglobin. This mutation causes the hemoglobin in red blood cells to distort to a sickle shape when deoxygenated. The sickle- shaped blood cells clog in the capillaries, cutting off circulation. Having two copies of the mutated genes cause sickle cell anemia, but having just one copy does not, and can actually protect against malaria - an example of how mutations are sometimes beneficial.

Color Blindness Most forms are caused by a point mutation on the X chromosome. What number do you see? A color blind person won’t see anything. A color deficient person may see the number 35

Achondroplasia This is the most common form of dwarfism. It is caused by a substitution mutation for the gene that codes for bone growth.