1 Addressable Bacterial Conjugation UC Berkeley iGEM 2006 Bryan Hernandez Matt Fleming Kaitlin A. Davis Jennifer Lu Samantha Liang Daniel Kluesing Will Bosworth Advisors: Professors Adam Arkin and Jay Keasling GSIs: Chris Anderson and John Dueber

2 Project Goal To establish specific cell-to-cell communication within a network of bacteria

3...and make a bacterial brain

4 Project Goal FR

5 Turning that into a brain F poolR pool Each cell can send a key or a lock

6 Turning that into a brain F type R type Most transfer events: 2 keys 2 locks Mismatched lock and key Sometimes the lock and key do match Key or lock transfer is activated or repressed

7 Implementation NEED: To transfer genetic information from one bacteria to another MEANS: Conjugation NEED: To specifically control who can read the message MEANS: Riboregulation NEED: A neural network MEANS: NAND gate Matt Fleming Jennifer Lu Samantha Liang Bryan Hernandez Kaitlin A. Davis Daniel Kluesing Will Bosworth

8 Conjugation Team

9 Bacterial Conjugation Certain bacterial plasmids are classified as having a “fertility factor” i.e. F + Cells that have a F + plasmid can conjugate and transfer their DNA to other bacteria F+F+ F-F- F Pilus Formation F FF F+F+

10 Relavent Information Conjugative plasmids are very large, from 60k – 100k basepairs long Many trans-acting genes are involved in the process DNA transfer begins at a specific sequence on the plasmid, OriT, the Origin of Transfer.

11 Modification of conjugative plasmids OriT is knocked out of the conjugative plasmid OriT is restored on a second plasmid that carries the message A tra gene necessary for conjugation is disrupted in the conjugative plasmid The tra gene is restored in trans but locked by a riboregulator

12 Conjugation Assays Donor-KanR/CmR/AmpR/TriS F/R plasmid (KanR) oriT (AmpR/colE1) tra (CmR/colE1) Recipient-KanS/CmS/AmpS/TriR Genome (TriR) F/R plasmid (KanR) oriT (AmpR/colE1) TriR KanR TriR AmpR

13 Status: RP4  Mutation and complementation of oriT works fine   traJ-R is insufficient to fully destroy transfer ability....need to knockout some other tra

14 " tra " genes " trb " genes Genetic Map of RP4

15 Genetic map of tra1 region

16 Literature Survey of RP4 genetics 1) To what degree does the mutant disrupt conjugation 2) To what degree does complementation restore conjugation 3) Can complementation be done from multiple plasmids 4) Are there multiple examples of disruption/complementation

17 Status: F  oriT plasmids can be transferred by wt F in trans...but not by the "O " isolate  PCR analysis of O  oriT locus shows it is wildtype O, T O T O

18 Should our oriT mutant be dead? Yes. Fu-1991

19 Literature Survey of F genetics  F plasmid transfer is leaky due to alternate mechanisms of transfer  trbC shows is the least leaky mutant identified

20 Riboregulator Team

21 The Riboregulator Isaacs et al., Nature Biotechnology, 2004 Method of translational control of gene expression cis-repressive sequence (“lock”) upstream of a gene’s coding region forms a hairpin, sequestering the ribosome binding site trans-activating (“key”) mRNA strand binds and opens the hairpin thus allowing access to the RBS. Highly specific activation occurs. Very similar lock and key pair sequences do not exhibit crosstalk

22 Biobricked Riboregulator RBS region Biobrick Mixed SiteAddress RegionHairpin loopStart of locked gene crR12 lock taR12 key Lock 1 Key 1

23 Results with lock3/key3 StrainFluorescence no plasmids31 lock3RFP44 key3 + lock3RFP78 OnRFP key3 lock3-RFP

24 Improved locks and keys Distance from RBS Presence of hairpin Position of terminator Transcriptional fusion Position of promoter Degree of homology Length of spacer

25 Key3b and key3c key3b Perfect duplex, No hairpin key3c Perfect duplex key3 3 point mutations off duplex StrainFluorescence no plasmids336 lock3RFP451 +key key3c1103 +key3b332

26 Improved locks and keys Distance from RBS Presence of hairpin Position of terminator Transcriptional fusion Position of promoter Degree of homology Length of spacer

27 Alternate hairpin structures key3d

28 BioBricks gaattcgcggccgcatctagagtactagtagcggccgctgcag EcoRI XbaI SpeI PstI

29 gaattcgcggccgcatctagagtactagtagcggccgctgcag cttaagcgccggcgtagatctcatgatcatcgccggcgacgtc gaattcgcggccgcat cttaagcgccggcgtagatc ctagtagcggccgctgcag atcgccggcgacgtc gaattcgcggccgcatctagtagcggccgctgcag cttaagcgccggcgtagatcatcgccggcgacgtc Digest Ligate

30 XbaI EcoRI SpeIPstI XbaI EcoRI SpeIPstI

31 XbaI EcoRI SpeIPstI XbaI EcoRI SpeIPstI XbaI EcoRI SpeIPstI

32 XbaI EcoRI SpeIPstI XbaI EcoRI SpeIPstI

33 XbaI EcoRI SpeIPstI XbaI EcoRI SpeIPstI XbaI EcoRI SpeIPstI

34 Biobrick plasmids: other origins p15A/CmR Biobrick pSB3C6

35 Functional suffixes and prefixes E-Ptet-X-SP pJ23006 E-Ptet-rbs-X-SP EX-S-rbsRFP-P

36 Suffix and prefix stuffers pSB1A2-b0015 pSB1A??-b0015

37 NAND Team

38 Conjugative NAND Gate tetR lock key tetR lock key tra TetR keylocktra

39 Conjugative NAND Gate tetR lock key GFPPlux luxI luxIluxRGFP luxR

40 The Wiki

41 Acknowledgements iGEM-2005 team Jonathan Goler MIT folks: Randy Rettberg Reshma Shetty Melissa Li Keasling Lab Arkin Lab Microsoft for funding