Protein synthesis Making proteins.

Slides:



Advertisements
Similar presentations
Nucleic Acids and Protein Synthesis
Advertisements

Unit 4 Part I Transcription.
Review: The flow of genetic information in the cell is DNA  RNA  protein  The sequence of codons in DNA spells out the primary structure of a polypeptide.
From DNA to Protein Section 11.2 Pg
Molecular Biology.
TRANSLATION/PROTEIN SYNTHESIS Unit 4 – Part 1. Central Dogma DNA mRNA Proteins Traits.
Translation (Protein Synthesis) RNA  protein. Making a protein Many RNAs needed –mRNA, tRNA, rRNA.
From gene to protein. DNA:nucleotides are the monomers Proteins: amino acids are the monomers DNA:in the nucleus Proteins:synthesized in cytoplasm.
Making Proteins Cell Structure (80% of cell membrane is proteins) Transport Channels Cell Processing Hormones (signals) Enzymes What else?
8.4 DNA Transcription 8.5 Translation
Protein Synthesis Chapter 11.
Protein Synthesis The production (synthesis) of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it.
Protein Synthesis. Review! What are some functions of proteins? What are some functions of proteins? Enzymes, which speed up chemical reactions Enzymes,
Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.
Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.
Chapter 13: RNA and Protein Synthesis
DNA to Proteins 3-4.
CFE Higher Biology DNA and the Genome Translation.
SC.912.L.16.5 Protein Synthesis: Transcription and Translation.
Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.
RNA and Protein Synthesis
Protein Synthesis Process that makes proteins
Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.
12-3 RNA and Protein Synthesis
Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.
Protein Synthesis What is protein synthesis? Is protein synthesis important? What is RNA? Where is RNA found? Is RNA similar to DNA? What is translation?
RNA AND PROTEIN SYNTHESIS
Protein Synthesis.
DNA Transcription & Protein Translation. DNA Transcription DNA must be copied to messenger RNA (mRNA) in the nucleus mRNA travels from nucleus to the.
Do Now: On the “Modeling DNA Transcription & Translation” handout, figure out the compimentary DNA sequence AND the mRNA sequence.
Decoding the message. DNA and RNA work together to produce proteins Remember: A protein is a specific sequence of amino acids.
Protein Synthesis: Transcription & Translation.
Protein Synthesis Making Proteins. Why Do We Need Proteins? 1.Cell Structure  Cell = 80% protein Cell membrane.
12.3 Protein Synthesis (Translation). Watch these animations and try to explain what is going on. ◦Animation 1Animation 1 ◦Animation 2Animation 2.
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
Why Do We Need Proteins? 1.Cell Structure Cell = 80% proteinCell = 80% protein Cell membrane.
Protein Synthesis. Review…  DNA:  Found in the nucleus  Double stranded  Contains the instructions for controlling the cell (including instructions.
PROTEIN SYNTHESIS The formation of new proteins using the code carried on DNA.
Protein Synthesis Making Proteins from DNA. DNA & the Nucleus DNA cannot leave the nucleus! So how can we get the information for making proteins out.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
Ch. 11: DNA Replication, Transcription, & Translation Mrs. Geist Biology, Fall Swansboro High School.
DNA to RNA to Protein. RNA Made up of 1. Phosphate 2. Ribose (a sugar) 3. Four bases RNA bases are: Adenine Guanine Cytosine Uracil (instead of thymine)
Ribosomes and Protein Synthesis
PROTEIN SYNTHESIS CHAPTER 10 section 4
How to Make a Protein?.
Do Now: Imagine you have an original Michaelangelo painting
Proteins and Translation
Transcription and Translation
How DNA and RNA make Proteins.
Protein Synthesis: Translation
Amino Acid Activation And Translation.
Ch. 12 Protein Synthesis.
Translation (Protein Synthesis) RNA  protein.
Unit 5: Protein Synthesis.
Nucleic Acids: RNA Ribonucleic Acid: RNA
Protein Synthesis Making Proteins
Transcription Steps to Transcribe DNA:
Review.
RNA - TRANSLATION.
Central Dogma of Genetics
Protein Synthesis RNA.
Translation Decoding the message.
Unit 7: Molecular Genetics
GENE EXPRESSION / PROTEIN SYNTHESIS
Ch Protein Synthesis Protein Synthesis Proteins are polypeptides
Higher Biology Unit 1: 1.3 Translation.
RNA.
Do Now: Imagine you have an original Michaelangelo painting
DNA Replication Living Environment 2015.
Presentation transcript:

Protein synthesis Making proteins

Review DNA and its concepts in a beat… DNA Song

Introduction to Protein Synthesis

Why do we need proteins? 1. Cell Structure Cell= 80% protein

Why do we need proteins? 2. Cell processes Hormones (signals) Enzymes (speed up reactions)

Why do we need proteins? 3. membrane channels (remember transport) 4. Neurotransmitters (carry nerve/brain messages)

Rna vs. dna

Dna in Protein Synthesis Template for making mRNA during transcription *Handout

RnA A. mRNA = messenger RNA B. tRNA = transfer RNA Makes and takes copy of DNA to cytoplasm B. tRNA = transfer RNA Matches w/ mRNA on ribosome Carries amino acid (AA) to protein chain C. rRNA = ribosomal RNA Part of ribosome Reads mRNA Directs tRNA *Handout

Ribosome rRNA Reads mRNA Directs tRNA Creates peptide bonds b/w AAs (makes polypeptide chain)

Amino Acids (AA) Building blocks of proteins Protein = AA chain (20 AA essential) Protein = AA chain A bunch of amino acids = polypeptide chain ORDER MATTERS! AA order determines f(x) of protein

Vocab Handout

Amboea Sisters explain Protein Synthesis Handout Notes

Steps of Protein Synthesis 1. Transcription (writing the “message”) DNA  mRNA Messenger carries code to cytoplasm animation of transcription

2. Translation (reading the “message”) mRNA leaves nucleus 2. Translation (reading the “message”) mRNA  tRNA  protein (AA chain) Message translated into a protein translation animation

Transcription DNA  mRNA 1. location: nucleus 2. Steps A. enzyme binds to DNA, unzips it B. mRNA copy of gene made from DNA template * U replaces T in RNA

Transcription 3 DNA nucleotides (triplet) mRNA codons Handout

translation mRNA  tRNA  protein (AA chain/polypeptide) Location: cytoplasm (first codon in mRNA is the start codon AUG)

Steps of translation 1. mRNA moves to cytoplasm, binds to ribosome 2. tRNA anticodon UAC brings AA (methionine) to mRNA codon on ribosome 3. ribosome moves down mRNA to next codon 4. tRNA anticodon brings and attaches next AA with pepide bond

5. tRNA leaves ribosome once AA attached

* UAG, UAA, UGA 7. polypeptide chain released from ribosome 6. steps 1-5 repeated, adding AAs until stop codon* signals end of protein 7. polypeptide chain released from ribosome translation animation animation 2 animation 3 * UAG, UAA, UGA Animation Handout

Let’s translation a try: Codon chart/wheel DNA song

Amino Acid fun! DNA triplet: ACC mRNA codon: UGG tRNA anti-codon: ACC Amino Acid: tryptophan Why should know this? Tryptophan is in TURKEY-makes you sleepy

Transcribe and Translate your DNA name into a protein

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2025 SlidePlayer.com. Inc. All rights reserved.