14.4 Gene Mutations. What is a Mutation? A mutation is any change in the amount or structure of the DNA of an organism. KEY POINT: If this occurs in somatic.

Slides:

Advertisements

Similar presentations

Chapter 12-Inheritance Patterns and Human Genetics

Advertisements

Decoding DNA Worksheet

Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.

Mutation and Genetic Change

Human Genetic Mutations

MUTATIONS SC STANDARD B-4.9: The student will exemplify ways in which new characteristics are introduced into an organism or a population.

Questions # 1 DNA carries the code for making proteins.

Mutations Chapter 12.4.

Cell Biology: Protein Synthesis Lesson 2 – Mutations( Inquiry into Life pg )

DNA Mutations What is a mutation? 1) Change in the DNA of a gene. 2) When a cell puts its genetic code into action it is making precisely the proteins.

Mutations. A Mutation is a change in an organism’s DNA  It can occur naturally whenever a base is incorrectly copied, especially during DNA Replication.

Chapter 11.6 Mutations. Definition- Mutation- a change in the DNA nucleotide sequence Mutation- a change in the DNA nucleotide sequence Types of mutations:

By Dean, Lisa, Nicola & Kunal Definition: a. A change of the DNA sequence within a gene or chromosome of an organism resulting in the creation of a new.

LS: I will be able identify and describe the different types of mutations.

MUTATIONS & HUMAN GENETICS Chapter 11.3, Chapter 12.

Genes and Gene Mutations. Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases.

DNA Mutations. What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.

12.4 Mutations Copyright Pearson Prentice Hall.. What Are Mutations? Changes in the nucleotide sequence of DNA (genetic material) May occur in somatic.

Mutations Mutations are changes in DNA Mutations are changes in DNA These can occur in: These can occur in: Somatic cells – can cause tumours/cancersSomatic.

GENETIC MUTATIONS What is this picture depicting?.

Gene Regulation and Mutation Notes and Questions How do mutations affect a cell?

Central Dogma of Molecular Biology Genetic information flows in one direction – from DNA to RNA to proteins.

Genetic Mutation. Mutation Greatest source of genetic diversity A change in the sequence of nucleotides of a gene. Some changes to the DNA will alter.

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.

Section 11.3: Genetic Changes

Genetics Lesson 4 Mutations.

Gene Mutations.

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

A change in the DNA sequence that affects genetic information

Chapter 21 Nucleic Acids and Protein Synthesis

Gene Mutations A change in the DNA of a gene is called a mutation. Mutations in gametes can be passed on to the offspring of the affected individual,

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Gene Mutations A change in the DNA of a gene is called a mutation. Mutations in gametes can be passed on to offspring of the affected individual,

Types of Mutations.

Copyright Pearson Prentice Hall

A change in the DNA sequence that affects genetic information

Mutations LN #23 Ms. Garcia California Content Standard Genetics

Types of point mutations

To be successful today…

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

Ch.6s.2 Genetics: Protein Synthesis

Chapter 11.6 When it all goes Wrong

A mutation is a change in an organism’s DNA.

Gene and Chromosomal Mutations

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Draw a conclusion from this graph for both the red and blue line

DNA: The Blueprints For Life

Copyright Pearson Prentice Hall

DNA Mutations Types & their effects.

Mutations: Changes in Genes

Presentation transcript:

14.4 Gene Mutations

What is a Mutation? A mutation is any change in the amount or structure of the DNA of an organism. KEY POINT: If this occurs in somatic (body) cells, the change cannot be inherited. Only mutations in the DNA within gametes can be passed on to the next generation.

Causes of Mutations Mutations occur naturally and at random. However, mutagens are environmental factors that increase rate of mutation. High-energy radiation High-energy particles from radioactive substances Mutagenic chemicals Carcinogenic substances such as tar and asbestos

Gene Mutations

Point Mutations These are point mutations involving a change of only one nucleotide at a particular locus. There are 3 types: 1.Substitution One nucleotide is replaced by another with a different base. 2.Addition An extra nucleotide is added so an extra base is added to the sequence. 3.Deletion One nucleotide is removed.

Substitutions Substitutions only affect one codon in a sequence of genetic material. They therefore only affect the outcome of a single amino acid. The above animation is a worst case scenario when it comes to substitution mutations. Why might a substitution mutation not have an effect on protein shape at all? G G C C T T A A G G T T A A T T A A C C G G T T A A ArginineTyrosine Alanine Serine