Project I Verifying the restriction map of a DNA insert

Objectives  Find out which gene you have (Bioinfo)  Generate a theoretical map (Bioinfo)  Verify map experimentally  Determine orientation

Mapping of Unk. Plasmids  Vector pUC19

Cloning in pUC19 X MCS Digested with X

Cloning in pUC19 X X + Insert

Determining Insertion Site Cut with X X X + Insert

X Delimits Right & Left Ex. If Pst is the insertion site: Bam is to the left. If Xba is the insertion site, then Bam is to the right

Determining Relative Orientation XXAA XXAA Orientation 1 Orientation 2

Project II Site directed mutagenesis of LacZ

Objectives  Use PCR to amplify and mutagenize the LacZ gene in pUC19  Use PCR to add appropriate restriction sites to the ends of the LacZ gene to allow cloning

DNA Replication & Amplification The Polymerase Chain Reaction

Polymerases 5’…GTACT 3’…CATGAATGCTGCATTTGCGGGCATTACTC…5’ Polymerase Primer -OH 3’OH end TACGACGTAAACGCCCGTAATGAG DNA or RNA Template

2 Types of DNA Polymerases :  DNA dependent  DNA dependent :  Requires a DNA template  Synthesize DNA  Ex. Taq polymerase  RNA dependent  Requires an RNA template  Synthesize DNA (cDNA)  Ex. Reverse transcriptase

14 The Polymerase Chain Reaction-PCR  Repetitive replication of a given region of DNA  Allows the exponential amplification of a given region of DNA  Increases the relative representation of the region of interest  Allows the isolation of a given region of DNA

PCR-1 st Cycle 5’ 3’ 5’ Denaturation (95 o C) Annealing of primers (Tm) 5’CATACCGTGGGGTGCA ……….. ACGCGTTGCGATGGCA3’ 3’GTATGGCACCCCACGA ……….. TGCGCAACGCTACCGT5’ 5’CCGTGGGGT3’> <3’GGAACGGTACCGT5’

  Extension (72 o C) 3’ 5’ 5’CATACCGTGGGGTGCA ……….. ACGCGTTGCGATGGCA3’ 3’GTATGGCACCCCACGA ……….. TGCGCAACGCTACCGT5’ 5’CCGTGGGGT3’> <3’GGAACGGTACCGT5’

PCR-2 nd Cycle 3’5’ 3’ 5’ ’ 3’ 5’ 3’ Annealing   5’ 3’ 5’ ’ Denaturation /Extension

PCR-Subsequent Cycles Only this template is amplified exponentially: 2 n times times total

Review of PCR Cycles  PCR Primers:  Short single stranded nucleotide sequences complementary to the targets  nucleotides  Used in excess as compared to target to favor primer annealing rather than template self annealing

Review of PCR Cycles  Annealing:  Temperature at which primers anneal to complementary target sequences  Must be below primer Tm  Must be a temperature that allows both primers to anneal  Usually between o C

Review of PCR Cycles  Extension:  Carried out at temperature optimum for DNA polymerase  Usually o C for Taq polymerase

Taq Polymerase  Isolated from a thermophillic bacterium Thermus aquaticus  Stable at the high temperatures (~95 o C) used for denaturing DNA  No exonuclease activity  No proof reading  Has deoxynucleotidyl transferase activity  Template independent polymerase activity  Adds dA to free 3’OH ends

23 Primers Characteristics: Characteristics: Short oligonucleotides complementary to sequences that flank the region of interest Short oligonucleotides complementary to sequences that flank the region of interest Establish the point of initiation of replication Establish the point of initiation of replication Establish the point of termination of replication Establish the point of termination of replication

24 Primer Design Autocomplementarity: 5’GGGGCCCC3’ GGGGGGGG CCCCCCCC Complementarity of the Pair: 5’GGGGAAAA3’ 3’CCCC TTTT5’

25 Primer Design 5’ complementarity 3’…………….ATGGGTATTGGCC…………………..-5’ Template CCATAACCGG-OH3’ 5’CGA 3’ complementarity 3’…………….ATGGGTATTGGCC…………………..-5’ Template TACCCATAACC TA-OH3’

26 Primer Design 5’ 3’ Region of interest 3’ Correct orientation Wrong orientation

27 Problem You wish to amplify the sequence represented by the box. Which primer pair represent the correct orientation to accomplish this? You wish to amplify the sequence represented by the box. Which primer pair represent the correct orientation to accomplish this? 5’-AAAAAAAAAAAA GGGGGGGGGGGGG-3’ 1- AAAAAA 2- TTTTTT 3- GGGGGG 4- CCCCCC

28 Utility of PCR  Amplification and isolation of a given region by changing its relative representation  Between 100bp and 10Kpb  Screening to determine the presence of a sequence of interest  Presence or absence of an amplification product  Site directed mutagenesis  Used to add or remove nucleotides from the original template