Restriction Enzyme Digestion & Southern Blotting of DNA

Experiment Goals Digestion of DNA by restriction enzyme Analyze digested DNA by electrophoresis Transfer digested DNA to nitrocellulose filters (Southern blotting).

Restriction Enzymes Restriction enzymes are endonucleases which catalyze the cleavage of the phosphodiester bonds within both strands of DNA. They require Mg+2 for activity and generate a 5 prime (5') phosphate and a 3 prime (3') hydroxyl group at the point of cleavage. The distinguishing feature of restriction enzymes is that they only cut at very specific sequences of bases, Often the recognizes sites are palindromic. N is the length of the genome and b is the restriction site length.

Restriction enzyme The enzyme EcoRI cutting DNA at its recognition sequence Different restriction enzymes have different recognition sequences. This makes it possible to create a wide variety of different gene fragments.

Restriction Enzyme There are hundreds of different REs from different microorganisms. Each RE cuts DNA at a specific “recognition sequence” of nucleotides. Examples: EcoRI-- GAATTC; AluI -- AGCT Restriction enzymes are traditionally classified according to the subunit composition, cleavage position, sequence-specificity and cofactor requirements.

Naming of Restriction enzymes Restriction enzymes are named according to the organism from which they are isolated. This is done by using the first letter of the genus followed by the first two letters of the species. Only certain strains or sub-strains of a particular species may produce restriction enzymes.

Restriction Enzyme Uses Recombinant DNA technology Cloning Replicates a sequence inserted into a host cell DNA restriction mapping A rough map of a DNA fragment DNA fingerprints Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single recombinant molecule.

A restriction enzyme requires a specific double stranded recognition sequence of nucleotides to cut DNA. Recognition sites are usually 4 to 8 base pairs in length. Cleavage occurs within or near the site. Both DNA strands in the site have the same base sequence when read 5' to 3'. Such sequences are called palindromes.

HinfI Restriction Enzyme Recognition Site:

Restriction enzyme is part of the cell’s restriction-modification system in bacteria. The phenomenon of restriction modification in bacteria is a small scale immune system for protection from infection by foreign DNA. Bacteria can protect themselves only after foreign DNA has entered their cytoplasm.

Unit Determination Assay One unit of restriction endonuclease is defined as the amount of enzyme required to digest one microgram of the appropriate substrate DNA completely in 60 minutes under the conditions specified for that enzyme.

Set up of a restriction enzyme reaction A RE reaction contains the DNA to be analyzed, A restriction enzyme, A restriction enzyme buffer mix. contains a buffering agent to maintain constant pH, and Mg++ (from MgCl2) as a necessary cofactor for enzyme activity.

Digestion by Restriction Enzyme Measure the DNA concentration Use the Nano-drop spectrophotometer to measure the concentration of DNA, this is used to determine the amount of HinfI restriction enzyme to be used. Digestion of DNA Mix the following components in a clean microtube. Mix gently and spin down for a few seconds. Incubate at 37°C for 16 hours. Component Volume nuclease-free water 16 μl 10X Buffer R 2 μl DNA (0.5-1 μg/μl) 1 μl HinfI (10 u/μl) 0.5-2 μl *

Analysis of DNA digestion Analyze products on 2% agarose gel containing ethidium bromide. Samples are prepared with loading dye and then loaded on the gel. Visualize the PCR product on UV transilluminator.

Electrophoresis of Genomic DNA Odd numbered lanes contain undigested genomic DNA Even numbered lanes contain digested genomic DNA Undigested DNA is represented by a sharp band near the wells of the gel, while smearing indicates digested DNA sample.

Southern Blotting

Southern Blotting A technique used in molecular biology to check for the presence of a particular DNA sequence in a DNA sample. The amount of DNA needed for this technique is dependent on the size and specific activity of the probe.

Uses of Southern Blotting Identify mutations, deletions, and gene rearrangements Used in prognosis of cancer and in prenatal diagnosis of genetic diseases Diagnosis of Leukemia's Detect variations in gene structure Identify homologous genes among different species

Principle The Southern Blot takes advantage of the fact that DNA fragments will stick to a nylon or nitrocellulose membrane. DNA molecules are first elctrophoresed and then transferred from an agarose gel onto a membrane. The membrane is laid on top of the agarose gel and absorbent material (e.g. paper towels or a sponge) is placed on top.

With time, the DNA fragments will travel from the gel to the membrane by capillary action as surrounding liquid is drawn up to the absorbent material on top. The membrane is now a mirror image of the agarose gel.

Performing Southern Blotting DNA Digestion with an appropriate restriction enzyme. Gel Electrophoresis run the digest on an agarose gel. Denature the DNA (usually while it is still on the gel). Transfer the denatured DNA to the membrane (blotting) Preparing the probe Hybridization Probe the membrane with labeled ssDNA. Detection Visualize your radioactively labeled target sequence.

2- Gel Electrophoresis 1- DNA Digestion Cut the DNA into different sized pieces. HinfI restriction enzyme is used. 2- Gel Electrophoresis Load digested samples onto agarose gel (typically 0.8 to 1.0% agarose). Run gel at maximum rate of 5 volts per cm.

3- Denature the DNA DNA is then denatured with an alkaline solution such as NaOH. This causes the double stranded to become single-stranded. Only ssDNA can transfer.

4- Blotting Transfer the DNA from the gel to a solid support. The blot is usually done on a sheet of nitrocellulose paper or nylon (a positively charged nylon membrane ). Transferred by either electrophoresis or capillary blotting. used. Nitrocellulose typically has a binding capacity of about 100µg/cm, while nylon has a binding capacity of about 500 µg/cm. Many scientists feel nylon is better since it binds more and is less fragile.

4- Blot Fixation The blot is made permanent (constant) by: Drying at ~80°C Exposing to UV irradiation

5- Preparing the probe It is a fragment of DNA of variable length (usually 100-1000 bases long), which is used to detect in DNA the presence of nucleotide sequences that are complementary to the sequence in the probe Must be labeled to be visualized Usually prepared by making a radioactive copy of a DNA fragment. Probing is often done with 32P labeled ATP, biotin/streptavidin or a bioluminescent probe.

6- Hybridization Hybridization-process of forming a double-stranded DNA molecule between a single-stranded DNA probe and a single-stranded target patient DNA.

6- Hybridization Steps for hybridization 1. The labeled probe is added to the matrix incubated for several hours to allow the probe molecules to find their targets 2. Any unbound probes are then removed. 3. The place where the probe is connected corresponds to the location of the immobilized target molecule.

probes 3’ – *ATCTCGGGAATC – 5’ add probe hybridization 5’ – …AAGCCTAGAGCCCTTAGCCAAAAG… – 3’ * ATCTCGGGAATC

7- Detection Visualize your labeled target sequence. If radiolabeled 32P probe is used, then you would visualize by autoradiography. Biotin/streptavidin detection is done by colorimetric methods.

Steps in Southern Blotting DNA extraction Disease gene Fragments of DNA appear as a smear DNA digestion Gel electrophoresis Paper towels Chromatography paper support Denaturation of patient’s DNA in gel Gel in NaOH Nylon filter Southern blot Gel This process takes ~8 days 10x SSC Blot dismantled Autoradiography X ray film Hybridisation: Stringency washes Radioactive probe added to filter cassette filter filter

Southern Blot of same DNA (final result on x-ray film)

Advantages and Disadvantages of Southern Blotting The exact location of a disorder does not need to be known Disadvantages They are rather time consuming Needs high quality/quantity DNA Radioactive

Animation http://highered.mcgraw-hill.com/sites/9834092339/student_view0/chapter17/restriction_endonucleases.html http://www.dnatube.com/video/11736/Restriction-Enzyme-EcoR1 http://www.dnatube.com/video/11813/Restriction-Enzyme-Digestion http://www.dnatube.com/video/11696/Restriction-enzyme-action-of-EcoRI http://highered.mcgraw-hill.com/sites/9834092339/student_view0/chapter17/dna_probe__dna_hybridization_.html http://www.dnatube.com/video/1512/Southern-blot