Lecture 1 Introduction to recombinant DNA Technology Dr Muhammad Imran

What is a gene? Gene is a piece of DNA which encode an RNA molecule which may encode a protein What is a genetic engineering? Set of techniques by which one can deliberately insert new piece/s of DNA into the existing DNA piece to modify the characters of an organism. Gene Cloning Set of experiments carried out to create a recombinant molecule and its propagation in an organism/host organism multiplication.

PCR: Polymerase Chain Reaction A reaction in which we use DNA polymerase to make the copies of fragment of DNA selectively amplified with the help of primers

History of rDNA Technology Gregor Mendel1850s and 1860s the birth of genetics

What genes are and how they work W. Sutton…the factors (genes) reside on Chromosomes TH Morgan ……. Endorsed Sutton…..and gene mapping started in 1910 and by 1922 nearly 2000 genes were mapped. Set of experiments by Avery, MacLeod, and McCarty in 1944, and of Hershey and Chase in 1952 proved that DNA is hereditary material and not the proteins

well-done Watson and Crick Structure of DNA was elucidated, genetic code cracked, and the processes of transcription and translation described Anticlimax era and frustration in late –1973 recombinant DNA technology or genetic engineering Gene cloning Kary Mullis discovered a revolutionary technique now called PCR

Gene Cloning T.A Brown 6 th Edition

Properties to DNA and its replication DNA is double helix Double helix is anti-parallel Replication only takes place from 5-3 Replication is semi conservative Replication is bidirectional

PCR: Polymerase Chain Reaction Quite different from gene cloning Very simple Easy to do less time consuming Economical Wide application

PCR temperature profile

Critical temperature

Melting temperature or Tm of Primers Melting Temperature or Tm. The Tm is the temperature at which the correctly base-paired hybrid dissociates (“melts”). Tm = (4 × [G + C]) + (2 × [A + T])°C TAB

Contents of the reaction dNTPs Tag (enzyme) Buffer Primers F and R Template MgCl 2 (NH 4 ) 2 SO 4 or not KCl

PCR reaction contents

Principle of Primer designing Few things to be considered while designing the primers ParametersOptimumComments Primer Length18-22 Primer Melting Temperature o C Primer Annealing Temperature T a = 0.3 x T m (primer) T m (product) – 14.9 GC Content40-60% GC Clamp Primer Secondary Structures Repeats4 dinucleotide repears allowed eg ATATATAT RunsConsecutive single nucleotide repeat of 4 max allowed (otherwise mispriming)

Continued……………….. ParametersOptimumComments 3' End Stability Avoid Template Secondary Structure Avoid Cross Homology

Primer for different purposes Simple primer (Universal) Degenerate primers ARMS PCR Primer Multiplex PCR primers Primers for protein expression Primers for site directed mutagenesis When we need them?

Simple Primer (universal primers) When we want to amplify a region for sequencing, homologous sequences are available to design primers in large number. 16S rDNA primers (Universal primer) When large data of identical sequences is known ClCuD universal primers Universal primers for sequencing clones in expression vectors or TA cloning vectors etc. T7 promoter forward: TAATACGACTCACTATAGGG T7 terminator reverse: GCTAGTTATTGCTCAGCGG

Degenerate Primers When the polymorphism in region to be amplified exist. When primers have to be designed from protein sequence or conserved protein domain

ACGTA/CA/gA/TC/gC/Tg/TA/C/gA/C/TA/g/TC/g/TA/C/g/T ACGTMRWSYKVHDBN

Degenerate primers cont……141 ACGTA/CA/gA/TC/gC/Tg/TA/C/gA/C/TA/g/TC/g/TA/C/g/T ACGTMRWSYKVHDBN F Primer 5’ACNgARgCNCARTAYgAR ATg3’

Reverse degenerate primer 233 ACGTA/CA/gA/TC/gC/Tg/TA/C/gA/C/TA/g/TC/g/TA/C/g/T ACGTMRWSYKVHDBN

ARMS (Amplification refractory mutation system)

Primers for protein expression I will update on this and for Site directed mutagenesis and send again