YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG By Di Wu and Brian Kahnamelli

 Introduction ◦ What is SAR? ◦ What did we know about NPR1 Before This Paper? ◦ What did we want to learn about NPR1?  Yeast Two-Hybrid Screen ◦ Mechanism of Action ◦ Limitations of YTH  Why in Tomato?  Experiments ◦ Yeast Two-Hybrid Screens ◦ In Vitro Binding Affinity ◦ Gel Shift Assays

 Basic Leucine Zipper Transcription Factors (bZIP)  Summary of Results  Impact and Implications  Future Research

 More than 70! Rice Blast Rice Bacterial Blight Rice false smut

1, Broad-spectrum resistance 2, Relatively long-term resistance 3, “healthy” resistance What is SAR? Systemic Acquired Resistance

 Forward genetic screen.

GroupScreensMutants obtained The year when finished Screening strategy Ryals, NovartisNon-immunity (NIM) nim1-1 to nim Infection assay after SAR elicitor treatment Dong, DukeNo PR-gene expression (NPR) npr BGL2::GUS reporter system In 1997, NPR1 gene was mapped and the protein sequence was examined.

 What do you know about NPR1 protein? **Wonderful time to improve your Participation Grade**

 593 amino acids, 67 kD  Two protein-protein interaction domains: BTB/POZ and Ankyrin repeats  Contains NLS  Multiple phosphorylation sites  Multiple conserved cysteine residues  No DNA binding domain npr 1-1 BTB ARD S NLSnpr 1-2nim 1-2

SSA receptor? ◦N◦No SA binding activity SSubcellular localization? ◦A◦Accumulation in nucleus after SAR induction TTranscription factor? ◦N◦No bona fide DNA binding domain SScreen for NPR1-interacting proteins (NIPs)

 Purpose ◦ To test protein-protein interactions  Requirements ◦ Reporter construct of interest in yeast ◦ cDNA prey library with spliced activating domain  Activating domain interacts with RNA pol to transcribe the reporter gene ◦ cDNA bait construct with spliced Yeast DNA binding domain (BD)  Binding domain interacts with promoter region of the reporter gene  Preparation ◦ Transfect yeast cells with both plasmids and grow on medium complementary to your reporter assay

Bait Construct: Plasmid Vector cDNA sequence of interest Binding domain Prey Construct: Plasmid Vector cDNA sequence of interest Activating domain

Reporter Gene BD AD Prey Bait RNA Pol

 Can you think of any limitations of the Yeast Two-Hybrid experiment?

 False Positive Results ◦ A) Bait already possess an Activating Domain ◦ B) Means of selection is error prone ◦ C) Prey possess a yeast binding domain – highly unlikely  False Negative Results ◦ A) Post Translational Modifications  Ex. Phosphorylation ◦ B) Scaffold protein interaction ◦ C) Internal Yeast Error  Protein Folding or Transcription error occurs

 Tomato Library was better characterized than Arabidopsis Library  Tomato Library possessed a positive control ◦ PTO-PTI ◦ Remove some possibility of False Negative  The quality of a yeast two-hybrid experiment hinges on the quality of a library ◦ Is what you’re finding legitimate?? ◦ Is what you’re not finding legitimate?

 Perform Yeast Two-Hybrid Experiment with known Tomato homologue of NPR1 ◦ Referred to as TomNPR1  Use NPR1 homologue of NPR1as bait ◦ Transfect Yeast with gene, spliced to DNA binding domain (BD)  Screen cDNA Library for potential binding (Prey) ◦ Transfect the same yeast with gene  Use of Leucine Drop out Plates ◦ Reporter genes allow yeast to produce Leucine and grow

Leucine or β-gal Activity BD AD Prey TomNPR1 RNA Pol

 Researchers found NIF1 gene led to positive Y2H result ◦ Leucine production, β-gal activity and colony survival

 Test each component alone to test for individual activity ◦ None found alone  Sequence and Characterize NIF1 ◦ Search Genebank for homologous structures in Arabidopsis ◦ NIF1 codes for last 2/3 of a bZIP Transcription Factor  Found Three candidates: AHBP-1b (TGA2), TGA6, and OBF5(TGA2) ◦ All are bZIP Transcription Factors

Figure 2. Sequence similarity between NIF1 and associated homologues

 Perform same experimentation in Arabidopsis to confirm that Tomato homologues respond under similar conditions  Only considering 3 possible candidates (bZIP proteins) ◦ AHBP-1b, TGA-6, and OBF5 as prey ◦ NPR1 as Bait

 All three bZIP proteins were capable of stimulating a Leucine and β-gal activity indicating protein-protein interaction

Conclude: All three TFs show increased function when compared to the negative control. NPR1 can potentially interact with all of these TFs.

 Because Yeast Two-Hybrid is error prone, confirmation by means of other experimentation is required  Researchers aimed to confirm results by performing an in vitro binding test ◦ Ni-NTA Resin Pull down Assay (Co-Purification)

Poly-histidine Tag NTA Scaffold Ni-NTA resin

Poly-histidine Tag NTA Scaffold Ni-NTA resin His-tagged TGA NPR1

NPR1 & AHBP-1b Crude Extract of NPR1 NPR1 & OBF5 NPR1 & AHBP-1b (alternate preparation) NPR1 & Resin alone (Neg. Control)

 Aim to find regions of NPR1 involved in TGA binding  Create truncated NPR1 gene constructs  Perform Yeast Two-Hybrid Screens with AHBP-1b (TGA2) prey expressed along with truncated NPR1 bait ◦ 1-177aa – amino term, 1 st exon ◦ 1-432aa – amino term, 1 st exon, ankyrin repeat domain ◦ aa – ankyrin repeat domain, carboxyl term ◦ 1-593aa – Total Protein  Truncations along exon/intron boundries

 Active regions appear to be amino end in combination with ankyrin domains ◦ segment shows activity equal to WT ◦ N-terminus alone shows little activity ◦ Ankyrin Repeat alone shows little activity

Figure 4a. Specific regions of NPR1 appear to be more important in regards to binding affinity

 Introduce point mutations into highly conserved amino acids within the Ankyrin repeat domains ◦ npr1-1 – histidine 334 to tyrosine ◦ npr1-2 – cysteine 150 to tyrosine  Perform Yeast Two Hybrid Screens with these mutants and observe activity

 Base Switches: CysteineHistadineTyrosine

 Mutations into conserved amino acids lead to complete abolishment of activity

Figure 4b. X-gal and Leucine drop out plates showing loss of activity in npr1-1 and npr1- 2 mutants Figure 4c. Immunoblot of NPR1 protein expression levels in WT and mutant constructs

Marc Jakoby et al Primary structure of bZIP domain Hydrophobic interaction surface of the helices O'Shea et al. 1991

Marc Jakoby et al Binding DNA sequences with an ACGT core. MADS-box TFs Recognizing the CArG-box

Plant bZIP transcription factors are classified into 10 groups Group D/ TGA/OBF family Clade II (TGA2/AHBP-1b, OBF5/ TGA5, TGA6) TGA2 Question: What phenotypes would you expect if the construct 35S::TGA2CT is introduced into col-0 background? NT: N-terminal region bZIP: required for DNA binding CT: responsible for NPR1 binding  TGA factors bind specifically to variants of the palindrome TGACGTCA. Two of these sequences separated by 4 bps are called an activation sequence-1 (as-1).

 Aimed to characterize the function of AHBP- 1b  PR-1 promoter region has as-1-like element ◦ Known to interact with bZIP proteins  Test binding affinity of AHBP-1b to PR-1 promoter ◦ Radio-labeled promoter region ◦ Non-labeled promoter region ◦ Non-labeled as-1-like sequence

Question: How is TGA binding to PR1 promoter sequence possible even without NPR1? as-1-like element: CTCTACGTCACTATTTTACTTACGTCATAGATG Mutated version: CTCTAttctACTATTTTACTTAttctATAGATG

 Band shift observed when AHBP-1b was present  Competitive binding seen between labeled and non-labeled promoter region  Non-competitive binding seen between labeled promoter region and mutated as-1- like element  AHBP-1b can specifically bind the PR-1 promoter region in vitro

 TomNPR interacts with NIF1  NPR1 interacts with TGA transcription factors via Ankyrin repeat and N-terminus domain ◦ Binding is specific and altered by single amino acid changes  TGA transcription factors interact with the binding domains of PR genes ◦ TGA2 binds to promoter region of PR1 specifically

 Research helped to further connect SA to SAR by connecting another link in the pathway ◦ Showed potential for redundancy as seen in three bZIPs capable of binding to NPR1  Added to body of knowledge regarding NPR1

 Examine bZIP and NPR1 in vivo  Loss of function and gain of function mutants ◦ Look at mutants lacking specific TGA TFs alone and in combination ◦ What else can NPR1 and TGAs activate?  Regulation ◦ How is NPR1 activity regulated?  What else would you be interested in knowing?

 TGA 2,5, and 6 have essential, redundant, and overlapping roles  TGA 5 over expression is sufficient to stimulate SAR  NPR1 regulation sensitive to redox changes

 Co-immunoprecipitation  In vivo protein fragment complementation assay (PCA) ◦ Bimolecular fluorescence complementation (BiFC) ◦ Restoration of dihydrofolate reductase (DHFR) acitivity

Protein fragment Complementation Assay (PCA) using DHFR enzyme No interaction interaction I’m a protoplast. Subramaniam et al Nat. Biotechnol.

Protein fragment Complementation Assay (PCA) using DHFR enzyme