The role of the SRY gene in determing sex.

Slides:



Advertisements
Similar presentations
Patterns of Chromosome Inheritance
Advertisements

Studying Segmentation Mutants in Balanced Stocks.
Annie Perales and Miranda Viorst
A genetic switch with memory: the lysis/lysogeny switch in phage 
Recombinant DNA Technology
Urogenital Development II & Sex Determination
Genetics.
Sex Determination Chromosomal Sex Determination
CHAPTER 15 THE CHROMOSOMAL BASIS OF INHERITANCE Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings Section B: Sex Chromosomes 1.The.
Copyright © 2005 Brooks/Cole — Thomson Learning Biology, Seventh Edition Solomon Berg Martin Chapter 13 Gene Regulation.
Four of the many different types of human cells: They all share the same genome. What makes them different?
Chapter 3 The Biological Basis of Life. Introduction Genetics is the study of how one trait transfers from one generation to the next Involves process.
DNA marker analysis Mrs. Stewart Medical Interventions Central Magnet School.
Developmental Genetics, I.How do different cell types become organized into tissues, organs & systems? II.Sex determination in Drosophila III.Sex determination.
E2A – bHLH transcription factor-fusion proteins in Leukemia
Key Area : 2 DNA, genes and chromosomes Unit 1: Cell Biology.
Sex Linked Traits Humans have 23 pairs of chromosomes.
Chromosomal Structure and Chromosomal Mutations
The Hunt for Chromosomal Determinants of Maleness— A gene mapping story……. The Hunt for Chromosomal Determinants of Maleness— A gene mapping story…….
SEX DETERMINATION.
SRY Gene on Chromosome Y Jon Scales Genetics Fall GTAACAAAGAATCTGGTAGAAGTGAGTTTTGGATAGTAAAATAAGTTTCGAACTCTGGCA 61 CCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACAATGCAATCATATGCTTCTGCTATG.
Human Genetics & Genetic Engineering Notes CP BIOLOGY MS. MORRISON.
Unit 4 Vocabulary Review. Nucleic Acids Organic molecules that serve as the blueprint for proteins and, through the action of proteins, for all cellular.
Sex determination Jonathan Wolfe
Human Chromosomes: Genotype/Phenotype Muhammad Faiyaz-Ul-Haque, PhD, FRCPath Human Chromosomes: Genotype/Phenotype Muhammad Faiyaz-Ul-Haque, PhD, FRCPath.
“REWIRING STEM CELLS: NEW TECHNIQUE MAY REVOLUTIONIZE UNDERSTANDING OF HOW GENES FUNCTION” AND “IMPORTANT DISCOVERY FOR DIAGNOSIS OF GENETIC DISEASES”.
Section 6-1 Chromosomes. Cell division is the same as reproduction of the cell. Gametes – an organism’s reproductive cells Females – eggs Males – sperm.
Biology 6.1 Chromosomes Chromosomes. Key ideas we will cover today...  Students will... ○ Differentiate between a gene, a DNA molecule, a chromosome,
Objective 10: TSWBAT explain the chromosomal basis of sex and the unique inheritance patterns of sex-linked genes.
Genetics and Inheritance Year 10 Biology Part 1: Genes & Chromosomes.
Huidi Liu, M.D. & Ph.D Genomics Research Centre Harbin Medical University, China Reduced expression of SOX7 in ovarian cancer: a novel.
THE EVOLUTION OF GENETIC MATERIAL ON THE Y CHROMOSOME AND ITS ROLE IN GENDER DETERMINATION Sam Taylor and Lauren Russell Biology 101H Dr. Jean DeSaix Dr.
The Genetic Basis of Development
Sex Determination. Sexual Reproduction For most diploid eukaryotes, sexual reproduction is the only mechanism resulting in new members of a species. Meiosis.
P53 Missense Mutation Cancer. Outline Disease related to p53 Role and regulation pathway Structure of p53 Missense mutation and consequences Experiment’s.
Chapter 3 The Biological Basis of Life. Chapter Outline  The Cell  DNA Structure  DNA Replication  Protein Synthesis.
MCDB 4650 Dosage Compensation. Which of the following is true of a worm that is homozygous mutant for xol-1 (lf)--one of the dosage compensation genes?
Topics for this lecture:
Evo-Devo: The merging of Evolutionary and Developmental Biology Eddy M. De Robertis HHMI/UCLA, USA 1)Cell differentiation self-regulates during animal.
You have body cells and gametes.
1 time * transcription factors expressed in large blocks
Human Genetics Chapter 12
Chromosomes and Cell Cycle. All genetic material of a cell is called the genome Genome is composed of DNA Long molecules of DNA organized for cell division.
P57: Beckwith-Wiedemann Syndrome Presented By: Jameeka Carrington.
Walter Sutton in 1902 proposed that chromosomes were the physical carriers of Mendel's alleles Walter Sutton in 1902 proposed that chromosomes were the.
14.1 Human Chromosomes Key Questions: 1)What is a karyotype? 2)What patterns of inheritance do human traits follow? 3)How can pedigrees be used to analyze.
Chapters 13 & 14 GENETIC ENGINEERING & THE HUMAN GENOME.
KEY CONCEPT 8.5 Translation converts an mRNA message into a polypeptide, or protein.
KEY CONCEPT Gene expression is carefully regulated in both prokaryotic and eukaryotic cells. Chapter 11 – Gene Expression.
Sex Determination.
Location of Genes and Gene Expression
Sex Linked Traits Humans have 23 pairs of chromosomes.
Chromosomal Basis of Inheritance Lecture 13 Fall 2008
Sex Testing of Women Athletes
Chromosomes, Genes & DNA.
The Differentiation of Vertebrate Immune Cells
UHRF1 is regulated by miR-9 in colorectal cancer
What does the word Promoter mean?
Sex Linked Traits Humans have 23 pairs of chromosomes.
INTRODUCTION TO MOLECULAR GENETICS
The Chromosomal Behavior of Inheritance
1 time * transcription factors expressed in large blocks
1 time * transcription factors expressed in large blocks
Sex Linked Traits Humans have 23 pairs of chromosomes.
INTRODUCTION TO MOLECULAR GENETICS
Prokaryotic Gene Regulation
SRY Gene Testis-determining factor (TDF), also known as sex- determining region Y (SRY) protein, is a DNA-binding protein (also known as gene-regulatory.
Analyze how environmental factors can influence a persons phenotype?
1 time * transcription factors expressed in large blocks
Nat. Rev. Rheumatol. doi: /nrrheum
Presentation transcript:

The role of the SRY gene in determing sex. Ahmed Mahmoud 10-29-2009

What makes a male or female? In mammals, gonadal development is determined by the sex chromosomes. XX usually constitutes female XY constitutes male How ever, some males have XX Some females have XY Why is this?

Key players in the sex determining game. SRY gene Stands for Sex determining region of Y chromosome. WNT signaling pathway a network of proteins used to control the production of wnt signaling molecules. WNT4- the gene that codes for a signaling protein that is involved in female gonadal development. β-catenin- protein complex that is used in the WNT signaling pathway. RSPO1 gene- encodes for a small secreted protein that is able to encourage the Wnt/β-Catenin signaling pathway.

History of the SRY Cladogram showing evolution of SRY Gene. Ucl.ac.uk

The Exact region was found out in 1990. The Y chromosome’s role in sex determination was known since the early twentieth century. The Exact region was found out in 1990. SRY region extends 897 base pairs long Exact location of the SRY gene on the Y chromosome

The SRY gene: The Male determining factor. SRY gene is located on the short arm of the Y chromosome This Gene causes male gonadal development.

SRY and The SOX family SRY is part of the SOX family of proteins that is characterized by a DNA binding domain. There are 20 SOX genes present in humans. SRY however does not have a transcription domain and closely works with another member of the SOX family; SOX9(SRY box-9). In XY individuals, SOX9 was found to increase in expression shortly after the beginning of SRY being expressed.

Sox9 Gene location & Info SOX9 is located on Chromosome 17 It is 5,401 pairs long genecards.org Location of SOX9 Gene

The female determining factors. R-Spondin 1 (Rspo 1) and The Wnt/β-Catenin pathway. Rspo 1 was found to increase in expression in XX females at the time of ovarian differentiation(1). Rspo 1 is needed to express the Wnt4 gene and it works through the stabilization of β-Catenin to develop ovaries and block testis. Rspo 1, Wnt4 and β-Catenin are all parts of one pathway to a ovarian result and block the development of testis.

RSPO1 Loci. 23,645 bases long WNT4 Loci. 25,722 bases long Genecards.org RSPO1 Loci. 23,645 bases long Genecards.org WNT4 Loci. 25,722 bases long

Pathways of determination. Int J Biochem Cell Biol. 2008; 40(12): 2889–2900

SRY blocks Wnt Pathway Lab experiment performed by Pascal Bernard HEK293T cells –Human embryonic kidney cells NT2/D1 cells-Human embryonic carcinoma cells TCF- T-Cell specific HMG box factor. Protein found in the above mentioned cells that plays a key role in Wnt signaling TOP-Short for TOPFLASH which is an assay which has a binding site for β-catenin to bind to the cell’s TCF protein FOP- short for FOPFLASH which is a a control for TOP. It contains a mutant binding site that is unable to bind to TCF protein. BIO- 6-bromoindirubin-3’-oxime. Used to Activate TOPFLASH Int J Biochem Cell Biol. 2008; 40(12): 2889–2900 When SRY was added, it reduced the activation of TCF/β-Catenin by two fold When BIO is added and no SRY is present, TCF/β-Catenin binding is strongly activated. As SRY is introduced, the cells with the binding site for TCF begin to slowly decrease.

Rspo1 activates β-Catenin signaling Experiment performed by Anne-Amandine Chassot Experiment sought out to show that Rspo1 controls the activation of the β-catenin signaling pathway. Urogenital ridges were stained for finding the Lef1 which is a gene involved in β-catenin signaling. An XX gonad positive for Rspo1 shows staining that represents the Lef1 gene for β-catenin signaling. Human Molecular Genetics 2008 17(9):1264-1277; doi:10.1093/hmg/ddn016 An XY gonad also positive for Rspo1 does not show staining for the Lef1 gene which may be due to the SRY genes inhibition of the signaling pathway. An XX gonad negative for Rspo1 showing no staining for the Lef1 gene. Proving that Rsp01 mediates the β-Catenin Signaling pathway.

SRY and Sex Reversal Sex Reversal syndrome (SRS) is a kind of genetic disorder which creates a conflict between gonad development and chromosomal phenotype. The incidence rate of Sex reversal syndrome occurs in about one in every 100,000 individuals SRS proves once more that the SRY gene is the most important male determining factor

A study male SRS 46 XX male sex reversal Study conducted on a 20 year male. Patient had undescended testicles. Physically, the patient had the sexual characteristics of a normal male. Slender skeleton and light beard.

Translocation of SRY. M NM F P The patients DNA and control samples were tested by PCR(Polymerase chain reaction)amplification in figure A. Figure B shows fluorescent microscopy on the patients DNA. Fluorescence in situ hybridsation of patients DNA showed a green fluorescence on the short arm of the X chromosome. This gen was translocated to Chromosome X from Chromosome Y. M NM F P PCR amplification showed that both the Patient (P) and the Normal male (NM) were consistent in showing a SRY fragment while the Normal female (NM) had no such fragments of SRY.

SRS in the Olympic games In the 1992 Barcelona Olympic games, female athletes were tested through PCR Over 2000 test were performed and of those, 15 were reported positive. In the 1996 Atlanta games, 8 reported positive. Gender Verification tests were abandoned in 1999 and still are to this day.

Conclusion SRY gene is the most important male determining factor. The pathway leading to ovarian development goes through the β-catenin/Wnt signaling pathway. The SRY gene can inhibit the usual pathway leading to ovarian differentiation. SRS is due to the translocation to an X chromosome.

References Bernard, Pascal.(2008). Human SRY Inhibits β-Catenin-mediated transcription. Int J Biochem Cell Biol,40(12),2889-2900 Nef, S., Vassalli,J.(2009). Complementary Pathways in mammalian female sex determination. Journal of Biology,8(74). Chassot, A.,Ranc, Fariba., Gregoire, E., Roepers-Gajadien, H., Teketo,M., Camerino, G., Rooij,D., Schedl,A. And Chaboissier, M.(2008). Activation of β-catenin signaling by Rspo1 controls differentiation of the mammalian ovary. Human Molecular Genetics,17(9), 1264-1277. Smith, C., Shoemaker,C.,Roeszler, K., Queen, J., Crews, D. and Sinclair, A.(2008). Cloning and expression of R-Spondin1 in different vertebrates suggests a conserved role in ovarian development. BMC Developmental Biology,8(72). Wang, T., Liu, J., Yang,J.,Chen,J. And Ye, Z.(2008). 46, XX male sex reversal: a case report and review of the genetic basis. First Int. Journal of Andrology, 41, 59-62. Ritchie, R., Reynard,J. And Lewis, T.(2008). Intersex and the Olympic games. J R Soc Med,101, 395-399. Marchal, J., Acosta, M., Bullejos, M., Diaz de la Guardia, R. And Sanchez, A. (2007).Genomics,91,142-151. Sinclair, A. (2001). Eleven years of sexual discovery. Genome Biology, 2(7), 4017.1-4017.3 Newton, G. (2003). SRY and sex reversal. Retrieved October 1, 2009, from http://genome.wellcome.ac.uk/doc_WTD020752.html.