Genome closure and finishing

Clone walking Already sequenced Unsequenced primer locations tgcatgatcgtgatcat acgtactagcactagtactgtagtcgatgcactgatcgatcgatcgatgctacgatgcatgct... clone insert (from shotgun library) sequencing primer direction of extension

PCR to close gaps Scaffold Design primers at these locations Run PCR for each pair of primers Primers must be in non-repeat sequences Primers must be as close as possible to each gap PCR works best if primers are less than 2kb apart

What about physical gaps? How to order and orient all scaffolds?

Traditional strategy: combinatorial PCR Design primers for each end of each scaffold With N/2 scaffolds and N “ends”, run a separate PCR reaction for every pair of ends (N choose 2) reactions = N(N-1)/2 Example: 24 physical gaps, 48 ends, PCR experiments will be:

Multiplex PCR actgagatatac gttgagatataa gcgacgctgctcccagcgctgttc

Multiplexing more primers Up to 12 primers per tube If any two primers surround the same gap, they produce a product If more than 2 pairs react, we get multiple products Let N = number of primers = 48 K = max primers/tube = 12

POMP: pipette optimized multiplex PCR minimize number of laboratory reactions with N=48, number of combinatorial PCRs is 1128 number of pipettings = 2256 POMP: 28 reactions, 104 pipettings

POMP Create pools of size K/2 = 6 Each of N=48 primers put into 1 pool So we create N/(K/2) = 8 pools, P1...P8 Now create multiplex PCR reactions with all pairs of pools (8 choose 2) = 28 reactions needed

POMP Guarantees that all primers are tested against all others Each reaction tests (12 choose 2) = 66 pairs Protocol tests 66*28 = 1848 pairs Only 1128 distinct pairs, so POMP has some redundancy - some pairs appear in more than one reaction

Pooling primers ACGTCGATGCATCGA GCATGCTCGTACGAT ACGTCGATGCATCGA ATCGTGACAGTGAACGCATCGATGCATGT ATCGTGACAGTGAAC GCATCGATGCATGT

Testing all Pools P1

How many pipette operations? 48 pipettings to create the pools (one for each primer) 2 pipettings to create each multiplex reaction mix Total: (28) = 104

Results: Streptococcus pneumoniae N=48 primers, N/2 = 24 scaffolds, 24 gaps 19 products observed in the first experiment Q: how many gaps closed?

Interpreting results Case 1: product appears with Pi and Pj, but not in any other lane containing Pi –see P2P6 or P7P8 on previous slide –purify and sequence product directly Case 2: product appears in Pi and Pj and also in other lanes containing Pi –thus two primers within Pi reacted –see pool P5 on previous slide

A: Deconvoluting pool P5: eliminate each of the six primers from the pool and run 6 standard PCRs Answer: p25 and p29

B: Pools P2 and P3 gave two products Could run 12 more PCRs: eliminate each of 12 primers and re-run multiplex PCR However, 5 of the 12 were eliminated by other results For example, primer p10 was eliminated by results from P1-P2 Answers: p11 in Pool 2 pairs with p13 in Pool 3 p16 in Pool 3 pairs with p8 in Pool 2

POMP requirements (Ideally) If no restriction on K, choose K based on N (where N = 2 x (#gaps)) Make pools of size K/2 Reactions: Pipettings:

POMP summary for S. pneumoniae Out of 48 gaps, 42 were closed Strategy employs slightly under N/2 reactions, thus expected number of products per tube is ~1 This was borne out in experiments This became a standard lab technique at TIGR