Modified Method for Combined DNA and RNA Isolation From peanut and Other Oil Seeds Phat M. Dang and Charles Y. Chen USDA-ARS, National Peanut Research Laboratory, Dawson, GA INTRODUCTION RNA isolation from plant seeds is a prerequisite for many seed specific gene expression studies and DNA is necessary in marker-assisted plant selection and other genetic studies. We describe a modified method described by Li and Trick (2005) to isolate both RNA and DNA from the same seed tissue and have been successful with several oil seeds including peanut, soybean, sunflower, canola, and oil radish. An additional LiCl precipitation step was added to isolate both DNA from RNA from the same seed tissues. RNA quality was evaluated using both spectrophometric analysis and agarose gel electrophoresis. Average ratios of 260/230 were above 2.0 indicating no contamination from phenolics and polysaccharides. RNA was shown to be suitable for RT-PCR based on Actin or 60S primer amplification and DNA was shown to have a single band on gel electrophoresis analysis. This result shows that RNA and DNA isolated using this method can be appropriate for molecular studies in peanut and other oil containing seeds. MATERIALS AND METHODS Plant materials Mature dry seeds were collected from soybean (Williams 82), sunflower (Hybrid 894), canola, oil radish, peanut (A-104, AP-4, AT-215, AT3085RO, C76-16, Exp , Exp3-1114, Florida 07, Flavor Runner 458, Georgia Green, Georgia 03L, Tifrunner, VC-2, and York) and were utilized for both RNA and DNA extraction. RNA/DNA isolation and quantitation Both RNA and DNA were isolated using a method utilizing guanidinium salt extraction buffer. For further purification, RNA was treated with DNase I (Ambion) and DNA was treated RNase (Ambion). Gel electrophoresis RNA samples were denatured and separated on a 1.2% agarose gel in MOPS buffer. DNA samples were separated on a 0.8% agarose gel in 1x TAE buffer. RT-PCR One microgram of total RNA was reverse transcribed with MMLV Reverse Transcriptase using oligo dT and resulting cDNAs were used as template for PCR reactions. Specific primers Actin_Fwd (5’-3’) CACATGCCATCCTTCGATTG and Actin_Rev (5’-3’) CCAAGGCAACATATGCAAGCT to produce a 150 bp PCR product. 60S(L19)_Fwd (5’-3’) AGAGGGAAGGTTTGGCTTGAC and 60s(L19)_Rev (5’-3’) CGGGAATTGGCCATGGA to produce a 60 bp PCR product. SUMMARY To facilitate transcript analyses and other genomic studies, the protocol we developed for DNA and RNA isolation from cultivated peanuts and other oil seeds yield high quality of DNA and RNA templates for PCR and RT-PCR reactions. This modified method that works for fresh, frozen, or dry seeds makes the technique more versatile and requires the same amount of time compared to other purification methods but significant improved quality and yield that is suitable for many genomic studies such as cDNA library construction, primer extension, subtractive hybridization, and genotyping for a mapping population. We expect that the utilization of this method will facilitate the improvement of automated high-throughput genomic techniques used in functional genomics studies of peanuts as well as in other oil seed crops. RNA/DNA EXTRACTION PROCEDURE 1.Place 10 mL of Solution I [100 mM Tris, 150 mM LiCl, 50 mM EDTA, 1.5% SDS, 2% PVP-40] in 40 mL conical tube, add 150  L of BME, and place on ice. Obtain liquid nitrogen and mortar and pestles. Weigh out 1 to 1.5 gram of seed. Grind seed in pre-chilled (with liquid nitrogen) mortar, grind thoroughly, place powder in Solution I, vortex to mix completely, and place on ice. 2.Add 0.5 volume (relative to starting buffer volume, 5 mL) of acid phenol, pH 4.3 to tube, mix thorough with vortexing or inversion for 5 minutes. 3. Add 0.5 volume of Chloroform:Isoamyl alcohol (CI, 24:1) to tube, mix thorough for 5 minutes, centrifuge at 13,000xg for 10 minutes, transfer supernatant (top layer) to fresh 40 mL tube. Be sure to note transferred volume. 4. Add 1 volume of Solution II [(2 M guanidine thiocyanate, 0.5 M sodium citrate, 1.5 M ammonium acetate), pH to 5.2, then add 1% lauryol sulfate], mix by gentle inversion, place at room temp for 10 minutes with occasional inversion. After 10 min, add 0.5 volume Phenol:Chloroform:Isoamyl alcohol (PCI, 25:24:1, neutral pH), mix for 5 minutes, centrifuge at 13,000xg for 10 minutes. Transfer supernatant (top layer) to a fresh 40 mL tube. Be sure to note transferred volume. 5. Add 0.55 volume (relative to transferred volume) 1.2 M NaCl, mix by inversion, then add 0.66 volume isopropanol, mix, place on ice in refrigerator for 1 hour, centrifuge at 13,000xg at 4 o C for 15 minutes, discard liquid, wash pellet with 2 mL of 70% ice cold ethanol, centrifuge for 5 minutes, remove liquid, dry for 15 minutes, resuspend in 2 mL DEPC-treated water. 6. Add 1 volume 4 M LiCl, mix, place on ice in refrigerator for at least 1 hr or overnight, centrifuge at 13,000xg for 15 minutes. Transfer supernatant to a fresh 40 mL tube for DNA isolation and retain tube with pellet for RNA isolation. For RNA: wash RNA pellet with 2 mL 70% ethanol, centrifuge at 13,000xg 5 minutes, discard ethanol and dry pellet, resuspend in 750  L of DEPC water. Store at -20 o C. For DNA: add 1 volume (relative to transferred volume) isopropanol, invert at least five time or until DNA precipitates, centrifuge at 13,000xg 5 minutes, wash DNA pellet with 2 mL 70% ethanol, centrifuge at 13,000xg 5 minutes, discard supernatant, dry pellet, resuspend in 750  L of 10 mM Tris, pH 7.5. Quantify both RNA and DNA using spectrophotometer. A-104 AP-4 AT-215 AT3085RO C76-16 Exp Exp Florida 07 Flavor Runner 458 Georgia Green Georgia 03L Tifrunner VC-2 York 28S 18S A-104 AP-4 AT-215 AT3085RO C76-16 Exp Exp Florida 07 Flavor Runner 458 Georgia Green Georgia 03L Tifrunner VC-2 York Soybean Sunflower Canola Oil radish Peanut Nanodrop Readings Oil Seeds Genomic DNA Soybean Sunflower Canola Oil radish Peanut 28S 18S Oil Seeds RNA 60 bp Soybean Sunflower Canola Oil radish Peanut No RT Control 60S (L19) PCR Peanut RNA Peanut DNA 150 bp A-104 AP-4 AT-215 AT3085RO C76-16 Exp Exp Florida 07 Flavor Runner 458 Georgia Green Georgia 03L Tifrunner VC-2 York No RT Control Actin PCR Nanodrop Readings