Connect! Why sometimes do we see albino animals? What causes albinism?

Slides:

Advertisements

Similar presentations

Genetic Mutations Frame-shift and point mutations.

Advertisements

Chapter 13.3 (Pgs ): Mutations

Mutations A mutation is a permanent change in the DNA or RNA sequence of a gene. There are two ways in which DNA can become mutated: 1.Mutations can be.

Chapter 8 Section 8.7: Mutations.

Mutations Section 12–4 This section describes and compares gene mutations and chromosomal mutations.

What is a mutation? Mutations are changes made to an organism’s genetic material. These changes may be due to errors in replication, errors during transcription,

Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.

14.4 Gene Mutations. What is a Mutation? A mutation is any change in the amount or structure of the DNA of an organism. KEY POINT: If this occurs in somatic.

12-4 Mutations Mutation: A Change in DNA Mutation – any change in the DNA sequence that can also change the protein it codes for Mutations in Reproductive.

Mutations. Change / alteration to the DNA of an organism They may be good, bad or have no effect A plant that can better tolerate the cold (GOOD) A change.

Mutations. WHAT?..... DO YOU SEE- WHAT HE SEES?

Mutations (12.4) State Standard

Chapter 11.3 Genetic Changes.

Genetics and Heredity. Gene-chromosome theory Genes are arranged in a linear sequence on chromosomes. Each gene has a definite position or locus The gene.

Mutations 3.29 Recall that mutation is a rare, random change in genetic material that can be inherited. 3.31 Understand that many mutations are harmful.

Mutations Chapter 12.4.

Genetic Changes 11.3.

BIG QUESTIONS: 1.ARE ALL MUTATIONS BAD? EXPLAIN.. 2.CAN EVOLUTION OCCUR IN ABSENCE OF MUTATIONS?

Objectives Know radiation and mutagenic chemicals increase the mutation rate and can cause genetic diseases and cancer. Application: Consequences of radiation.

Mutations Genetic Changes.

Genetic Mutations Increasing Genetic Diversity May 4, 2010.

1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.

MUTATIONS & HUMAN GENETICS Chapter 11.3, Chapter 12.

Slide 1 of 24 Copyright Pearson Prentice Hall 12-4 Mutations 12–4 Mutations.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

MUTATIONS. Mutant An organism expressing a mutated gene.

Slide 1 of 24 VIII MUTATIONS Mutations Types of Mutations:

Slide 1 of 24 Copyright Pearson Prentice Hall Biology.

8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.

Genetic Mutations Occur in any organism, from people and other animals to plants, bacteria, fungi, and protists. A mutation is any change in the nucleotide.

A change in the nucleotide sequence of DNA Ultimate source of genetic diversity Gene vs. Chromosome.

Mutations. We all make mistakes. Sometimes cells make mistakes, too -- -like when they copy their DNA.

Objective: To discuss different mutations Gene mutation Mutations: change in genetic material Gene Mutation: change is on one or a few nucleotides.

Higher Biology Mutations part 3.

Section 11.3: Genetic Changes

Mutations 6/26/2018 SB2d.

Copyright Pearson Prentice Hall

A change in the DNA sequence that affects genetic information

Bell Ringer: 11/21/17 Objective: Explain that mutations occur during DNA replication or transcription and may be random or a result of environmental agents.

Mutations 12-4.

Mutations TSW identify and describe the various types of mutations and their effects.

Types of mutations Mutations are changes in the genetic material

A change in the DNA sequence that affects genetic information

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

11.3 Section Objectives – page 296

Mutations And Genetic Disorders

Given a DNA strand ACTTCA, what is the mRNA strand?

Recombinant DNA & Mutations

Mechanisms for the Diversity of Life

Chromosomal Mutations

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Objective: Explain the main types of mutations

Genes & Mutations Miss Richardson SBI4U.

11.3 Section Objectives – page 296

Section 20.4 Mutations and Genetic Variation

Copyright Pearson Prentice Hall

Academic Biology Notes

Changes in DNA TEK 6E: identify and illustrate changes in DNA and evaluate the significance of these changes.

Mutations 1) Gene Mutations = change in pattern of DNA bases

Mutations Big Q: What are mutations?

DNA Mutations Types & their effects.

Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall

Presentation transcript:

Connect! Why sometimes do we see albino animals? What causes albinism?

2. GENE MUTATIONS are random changes in the chemical nature of genetic material (DNA); smaller sections of the DNA are changed compared to chromosomal mutations are random changes in the chemical nature of genetic material (DNA); smaller sections of the DNA are changed compared to chromosomal mutations

Sometimes the effects of a gene mutation are obvious such as albinism while other mutations are not as noticeable. Usually mutations are recessive and harmful

Gene mutations can be an insertion (extra gene), a substitution (different gene), or a deletion (missing gene). Also possible are duplication and inversion.

Ask lynn where she got gene 1 and 2 deletion diagram, insert here

3. MUTAGENIC AGENTS cause an increase in mutations (even though mutations can occur spontaneously) cause an increase in mutations (even though mutations can occur spontaneously)RadiationX-rays ultraviolet rays cosmic rays radioactive substances substances

Chemicalsformaldehydebenzene asbestos fibers

CHUNK TIME! Compare chromosome mutations with gene mutations. Mutations are usually _____ and ______. Describe insertion and deletion. Define mutagenic agent. Name 3 types of radiation mutagenic agents. Name 3 types of chemical mutagenic agents.

Just For Fun