FilmArray: Automated PCR

Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge gained from Biology?

PCR: A Quick Review Polymerase Chain reaction: Quiz: what do you know?

Components of PCR 5’ 3’ TCCACAGGCGCTATCTGCT AT C Free nucleotides C C G A T Taq polymerase T Primer 5’ 3’ TCCACAGGCGCTATCTGCT AT C G AGGTGTCCGCGATAGACGATAGCGAGTAGCAGAGGTTTAGA 3’ 5’ Template DNA Buffers

PCR Process -Heat denatures template strand -Forward and reverse primers are annealed to single stranded DNA -Taq polymerizes dNTP’s to elongate the replicated strand.

PCR Amplification Original DNA Copy 5 cycles of PCR amplify 1 copy into 32………and so on

Instruments for Viewing PCR Results Gel Electrophoresis and Camera image of agarose gel

PCR in the Classroom How long does PCR take?

Improving the Process: PCR today New Concepts Biotechnology industry utilizes many new improvements in conducting and analyzing the PCR process

Fluorescent DNA: DNA Binding Molecules GCAATCGTGTCATGTCTG = CGTTAGCACAGTACAGAC + GCAATCGTGTCATGTCTG CGTTAGCACAGTACAGAC Fluorescent molecules that bind to double stranded DNA help make it visible. Works like ethidium bromide in gel electrophoresis

Camera Records a Fluorescent Image Every Cycle Visible Realm Greater Than 10 Billion Copies Number of DNA Copies PCR Cycle 1 5 10 15 20 25 30 40

Uses a camera and Software to plot fluorescence during PCR Real-Time PCR Uses a camera and Software to plot fluorescence during PCR

Nested PCR Nested reaction includes: 1. outer PCR (PCR1) 2. dilution 3. inner PCR (PCR2) *allows for more specific amplification of selected organisms

Nested RT-PCR Primer Designs Virus Genome Outer RT-PCR 200bp Inner PCR 90bp

Multiplex Assays Uses multiple primers in one reaction to amplify several different DNA templates present in a sample i.e.: clinical sample run on a panel of 20 organisms to determine presence of infection

Schematic of Nested Multiplex PCR Primary RT-PCR Secondary PCR 1F 1R 2F 2R 3F 3R 4F 4R 5F 5R 6F 6R Dilute 100 fold

Primer Design Primer of 17 base pairs has 1 in 10 billion chance of laying down on human genome. Design never goes below 17 bp (usually 18-20bp) AGGCGCTATCTGCT ATC 5’ 3’ AGGTGTCCGCGATAGACGATAGCGAGTAGCAGAGGTTTAGA 3’ 5

Our Project: FilmArray

Collaboration Chemists: PCR reactions occurring in the pouch Engineers: Pouch development and Instrument development Software: Communication from instrument to computer, analysis of data Film Array instrument allows for automated PCR with results in approximately 1 hour

FilmArray Pouch Pouch substitutes pipettes and tubes for mixing Cell Lysis PCR1 PCR2 Mag Bead Capture Dilute Wash FilmArray Pouch Pouch substitutes pipettes and tubes for mixing substitutes chemist on a bench-top FLASH ANIMATION

FilmArray Beta Prototype Substitutes mechanical actions of chemist and bench-top instruments (bead whacker=vortex, mag. beads and blisters=filter tubes and centrifuge, peltier=thermo block, array=DNA detection

Run Protocol DNA Melt Green indicates camera acquisitions: 2nd PCR 1st PCR Green indicates camera acquisitions: Once per PCR2 cycle 2500 in the 5 min melt There are two Peltier Thermocyclers The software displays the temperature during each PCR and the melt

Example of Results Software makes call, positive or negative result PCR1 Control PCR2 Control Sc DNA assay Sc RNA assay Sp DNA Assay Sp RNA Assay 2nd PCR Post PCR Melt Software makes call, positive or negative result

Film Array Utilizes Faster Process Sample utilization: 120 1uL reactions = 1/10 price Pre amplification (PCR 1= enrichment) amplifies enough to cover entire array every well Some micro-array processes have difficulty having enough sample for every well

Risks of PCR Contamination is a HUGE risk factor Nesting not to popular because of how easily you can contaminate your assays False positives look the same as true positives The pouch is an all enclosed environment that eliminates the risk of contamination

Reagent Lyophilization All reagents in the pouch or lyophilized (freeze dried) so all that is needed is water Freeze Dried reagents can have a shelf life of approximately 1 year Wet Bench Top reagents have short shelf life Proteins are protected with “cake” so they don’t die

Film Array Applications: Projects Under Development Respiratory Panel: Clinical Samples Febrile Infant Risk Stratification Tool (FIRST): bacterial identification for infant fever Biothreat Pouch:Department of Defense Methicillin Resistant Staph. aureus detection:characterizing outbreaks of Staph infection in the hospital and community Tuberculosis Screening

Respiratory Panel Resp. Panel screens samples for 16 viruses or bacteria in 1 hour

Micro-array: Automated Pipetting

Spots Primers in specific layout

Kody (BioChemistry Intern) Pouch Production Freeze Dry Reagents Reagent QC Primer Validation and Tracking Assay Optimization Pouch/Protocol Optimization Build and Update Database

Meghan (Research Associate I) NanoPlotter validation and QC Film Array instrument optimization Assist with pouch production

Idaho Technology Broad range of projects Great experience, resume builder Offers career opportunities, internships, and benefits Visit:http://www.idahotech.com/work_with_us/ Join the ITI Team                                                       

Questions?