Reading the blueprint of life DNA sequencing

Introduction The blueprint of life is contained in the DNA in the nuclei of eukaryotic cells and simply within prokaryotic cells. Human genome project – just obtain the list of approximately 3x10 9 bases (As, Cs, Gs and Ts) in the 23 chromosomes. Extraction of useful information from this list and genome sequence of other organisms relies on computer-intensive data handling – Bioinformatics.

Sequencing The DNA from the genome is chopped into bits- whole chromosomes are too large to deal with, so the DNA is broken into manageably-sized overlapping segments. The DNA is amplified by cloning into bacteria (PCR, see later, doesn’t produce enough and requires sequence information for the primers). It is then denatured (ie. melted), so that the two strands split apart.

Sequencing- continued Denatured DNA is added to reaction mix with: – a primer (to start complementary pairing), –DNA polymerase –nucleotides including special ones called dideoxynucleotides. These special nucleotides do not allow further nucleotides to be added to the chain. So in a mix with dideoxy-A, every time a dideoxy-A is added (small proportion of As), the reaction ends. This results in different length fragments. The dideoxynucleotides are fluorescently tagged. Fragments can be separated out on a gel by electrophoresis and their length calculated. Working out DNA sequence ~ jigsaw puzzle.

DNA sequencing – preparation In order to sequence a piece of DNA, first need to amplify it. This is sometimes done by a process called polymerase chain reaction (PCR). PCR: The necessary ingredients for DNA replication are 1) the DNA itself, 2) DNA polymerase, 3) free nucleotides and 4) primers - Place all these in a test tube.

DNA amplification - PCR Step 1 – heat to c. 95°C for 30s – this denatures the DNA and unzips the two strands Step 2 – cool to c. 55°C for 20s, this causes the primer to bind to the DNA Step 3 – heat to c. 72°C for a minute per kb (kilobase)– this allows the polymerase to catalyse the addition of free nucleotides to the primer, replicating the DNA. So in two minutes a c. 1kb piece of DNA is replicated. Repeat for a few hours  a million copies.

DNA Amplification - cloning An alternative to PCR is to insert the piece of DNA into the DNA of a bacterium. Replicating the bacterium thus replicates the DNA. Cf. recombinant DNA technology

Sequencing using gel electrophoresis Here is a gel with 28 DNA samples: green bands represent A, blue C, yellow G and red T. Small molecules move faster.

Sequence assembly using mapping Originally sequencing was performed by cutting the chromosomes into large pieces which were cloned into bacteria, creating a whole library of DNA segments. The segments were cut open to look for common sequence landmarks in overlapping fragments. These were used to fingerprint the fragments, so that it was known where in the chromosome the fragment was- this is called mapping. The fragments were cut into smaller pieces and the process repeated and the small fragments were sequenced. Finally the whole sequence is known (in terms of short fragments and their locations on the chromosome).

Shotgun sequencing Shotgun sequencing dispenses with the need for mapping and so is much faster. It involves chopping the DNA into fragments of size c base pairs (bps) and bps, sequencing the first and last 500 bps of each fragment. It then uses computer algorithms to assemble the entire sequence from the sequenced fragments.

Speed and accuracy of sequencing Shotgun sequencing is much faster- it took a matter of months to obtain a draft sequence of the fruit-fly, Drosophila Melanogaster (135Mbps), when the state-funded conventional sequencing effort had taken several years to achieve a similar level of completion. BUT assembly of pieces, in eg. the human (3x10 9 bps), requires very powerful computers AND repetitive DNA, which is common in eukaryotic genomes, causes great difficulties in the assembly process – may get it wrong.

Acquisition of sequence data Genomes must be sequenced several times over on average, both to ensure complete coverage of the genome is achieved, and because sequencing data is somewhat error-prone. Increases in the efficiency of sequencing have led to a year on year increase in the rate of new sequence data acquisition:

Statistics of genome sequences Statistics can be global or local: Base composition of genomes: Bacteria (E. coli): 25% A, 25% C, 25% G, 25% T Mosquito (P. falciparum): 82%A+T Human: 59%A+T Translation initiation: ATG is the near universal motif (codon) indicating the start of translation in DNA coding sequence.

Databases of sequence information Internet has become a vital resource in making sequence data generally available to the biological community at large. Examples: GenBank ( EMBL ( DDBJ ( Used for: gene prediction, protein structure/ function prediction, homology searching

Extracting important information The most important parts of the genome are the genes. Efforts have been made to identify genes out of sequence data. Expressed sequence tags (ESTs) are short pieces of sequence data that correspond to mRNAs found in cells of the organism. ESTs are produced by purifying mRNA from cells and then using an enzyme called reverse transcriptase to convert these to copy DNA (cDNA). The DNA is then cloned in bacteria and sequenced. The sequence obtained is usually only short (c. 700 base pairs) and may not be very accurate, but ESTs still provide very useful information.

Gene prediction A weakness of ESTs is that it is very difficult to obtain them for genes which are expressed at a low level/ only under certain conditions, also slow, so People try to predict where in sequence the genes are. In prokaryotes, just look for long stretches of DNA without stop codon in any of the 6 reading frames.

Open reading frames There are 6 reading frames, 3 forwards: And 3 backwards (on the other strand). A frame is said to be open if it contains long stretches without a stop codon. [Lower lines are single-letter amino acid codes, *=stop.] 5' 3' atgcccaagctgaatagcgtagaggggttttcatcatttgaggacgatgtataa 1 atg ccc aag ctg aat agc gta gag ggg ttt tca tca ttt gag gac gat gta taa M P K L N S V E G F S S F E D D V * 2 tgc cca agc tga ata gcg tag agg ggt ttt cat cat ttg agg acg atg tat C P S * I A * R G F H H L R T M Y 3 gcc caa gct gaa tag cgt aga ggg gtt ttc atc att tga gga cga tgt ata A Q A E * R R G V F I I * G R C I

Gene prediction in eukaryotes In bacteria, open reading frames (ORFs) are pretty much enough to indicate genes, but in eukaryotes finding genes is more complicated, because 1.Eukaryotic DNA is roughly 97-98% noncoding- in such a large amount, ORFs may exist by chance. 2.Eukaryotic DNA contains introns, so finding the start and the end of a gene is not enough- also have to find which bits (introns) to edit out of sequence. Also introns break up open reading frames.

Introns - reminder Mentioned in “Introduction to Molecular Biology” These are pieces of DNA within genes, which are transcribed but then spliced out of the RNA before it is translated. They make it much harder to find genes, since finding open reading frames is not enough, you also need to find where introns and exons start and end.

Conclusions Sequencing DNA involves: –Amplifying it by PCR or cloning –Chopping it up into manageable bits –Replicating it with fluorescently-tagged dideoxynucleotides –Running the different length fragments on a gel and reading this –Assembling the pieces (sequences of manageable bits). Shotgun sequencing is faster than mapping- based assembly methods, but can have accuracy problems.

Conclusions Sequence data is stored in online databases Extracting useful information and patterns from such data is part of bioinformatics and often employs intelligent systems techniques.

Next block of lectures History of genomics Introduction to bioinformatics More on gene prediction