Supplementary Online Information. SOI Fig 1 Preliminary microarray data on dysregulation of angiogenic proteins by butyrate In a preliminary experiment,

Slides:

Advertisements

Similar presentations

Supplementary Figure 1. AB Supplementary Figure 1. L1 and Alu retrotransposition assay. A. Schematic of L1 retrotransposition plasmid (L1). ORF1 and ORF2.

Advertisements

Analysis of Transgenic Plants. 1.Regeneration on Selective Medium Selectable Marker Gene.

Supplementary Figure 1. mRNA induction/repression kinetics of HXK1, GAL1::FMP27 and INO1 (A) RT-qPCR analysis of HXK1 kinetic response to Galactose induction.

Supplementary Figure Legends: Table 1. List of primers used for Real Time – PCR Supp Fig 1. S100A7-overexpressing MCF7 cells show decreased formation of.

Fig. S1 Beclin1, ATG3 and LC3B mRNA -real-time quantitative PCR HCT-116 HT-29.

High molecular weight hyaluronic acid regulates osteoclast formation by inhibiting receptor activator of NF-κB ligand through Rho kinase W. Ariyoshi,

Dietary apigenin regulates high glucose and hypoxic reoxygenation-induced reductions in apelin expression in human endothelial cells Kazuo Yamagata,

Figure 1. miRNA processing and primer design

Figure 1. Inhibition of GSK3β reduces MiR biogenesis through repression of pri-MiR processing. (A) qRT-PCR analysis of miR-27a, miR-23a, miR-24, miR-141.

Anandamide inhibits the Wnt/β-catenin signalling pathway in human breast cancer MDA MB 231 cells Chiara Laezza, Alba D’Alessandro, Simona Paladino, Anna.

PLANT BIOTECHNOLOGY & GENETIC ENGINEERING (3 CREDIT HOURS)

The distribution and function of the Adenovirus L4-33K protein

A B C D Supplementary Figure 1 CMV p300

High molecular weight hyaluronic acid regulates osteoclast formation by inhibiting receptor activator of NF-κB ligand through Rho kinase W. Ariyoshi,

a c b NcoI Endogenous Cbfb NcoI 15,727bp NcoI NcoI BamH1 BamH1

Volume 9, Issue 3, Pages (March 2009)

Antiangiogenic antithrombin down-regulates the expression of the proangiogenic heparan sulfate proteoglycan, perlecan, in endothelial cells by Weiqing.

by Susan E. Shetzline, Ravikumar Rallapalli, Kelley J

Volume 66, Issue 1, Pages (July 2004)

Membrane-Tethered Intracellular Domain of Amphiregulin Promotes Keratinocyte Proliferation Stefan W. Stoll, Philip E. Stuart, Sylviane Lambert, Alberto.

CD271 on Melanoma Cell Is an IFN-γ-Inducible Immunosuppressive Factor that Mediates Downregulation of Melanoma Antigens Junpei Furuta, Takashi Inozume,

Histone deacetylase inhibitors suppress mechanical stress-induced expression of RUNX-2 and ADAMTS-5 through the inhibition of the MAPK signaling pathway.

Inhibition of ILK restores epithelial ZO-1 and E-cadherin and inhibits fibronectin and Snail1 expression after TGF-β1 treatment. Inhibition of ILK restores.

Skin-Specific Expression of ank-393, a Novel Ankyrin-3 Splice Variant

Signal transduction pathways triggered by the FcϵRIIb receptor (CD23) in human monocytes lead to nuclear factor-κB activation Rosa M. Ten, MD, PhDa,

Altered microRNA expression in stenoses of native arteriovenous fistulas in hemodialysis patients Lei Lv, MD, Weibin Huang, MD, Jiwei Zhang, MD, Yaxue.

J.E. Lafont, F.-A. Poujade, M. Pasdeloup, P. Neyret, F. Mallein-Gerin

Volume 117, Issue 2, Pages (August 1999)

TGF‐β1 and Sema3A are downregulated in vivo by increasing VEGF doses Muscles were harvested 7 days after implantation of V Low, V Med, and V High clones.

Osteogenic Protein-1 inhibits matrix depletion in a hyaluronan hexasaccharide-induced model of osteoarthritis1 1 Supported in part by NIH grants P50-AR39239,

Volume 132, Issue 2, Pages (February 2007)

Mitochondrial HMGB1 is linked to mitochondrial functions Western blot with separated cellular components from the cerebellar tissues of the three genotypes.

Kinesin and Kinectin Can Associate with the Melanosomal Surface and Form a Link with Microtubules in Normal Human Melanocytes1 Garnet Vancoillie, Jo.

Volume 62, Issue 3, Pages (September 2002)

Supplementary Figure 1 RT-PCR BclxL mismatch sc35 Dox BclxS

Osteopontin Gene is Expressed in the Dermal Papilla of Pelage Follicles in a Hair- Cycle-Dependent Manner Tian Yang, Pamela J. Jensen, Robert M. Lavker

Volume 121, Issue 6, Pages (December 2001)

Leukemia inhibitory factor increases the invasiveness of trophoblastic cells through integrated increase in the expression of adhesion molecules and pappalysin.

H. Randolph Byers, Mina Yaar, Mark S. Eller, Nicole L

Notch1 Signaling Promotes the Maturation of CD4 and CD8 SP Thymocytes

Fig. 1 BX795 suppresses HSV-1 infection.

Histone deacetylase 1 protein depletion affects general histone acetylation and specific gene expression. Histone deacetylase 1 protein depletion affects.

Volume 59, Issue 2, Pages (August 2013)

The Melanocortin 5 Receptor is Expressed in Human Sebaceous Glands and Rat Preputial Cells Diane Thiboutot, Aruntha Sivarajah, Kathryn Gilliland, Zhaoyuan.

Matrix metalloproteinase-13 influences ERK signalling in articular rabbit chondrocytes L.J. Raggatt, Ph.D., S.C. Jefcoat, M.S., I. Choudhury, Ph.D., S.

Effects of ERK–GFP expression levels and cell density on ERK phosphorylation and oscillations. Effects of ERK–GFP expression levels and cell density on.

Volume 17, Issue 1, Pages (January 2010)

Essential Role of TGF-β Signaling in Glucose-Induced Cell Hypertrophy

Characterization of Keratinocyte Differentiation Induced by Ascorbic Acid: Protein Kinase C Involvement and Vitamin C Homeostasis1 Isabella Savini, Antonello.

Resistance of Human Melanoma Cells Against the Death Ligand TRAIL Is Reversed by Ultraviolet-B Radiation via Downregulation of FLIP Elke Zeise, Michael.

PPARδ Is a Type 1 IFN Target Gene and Inhibits Apoptosis in T Cells

Inclusion of jaagsiekte sheep retrovirus proviral elements markedly increases lentivirus vector pseudotyping efficiency Patrick L. Sinn, Erin R. Burnight,

Limited transcriptomic changes upon HOTAIR RNA overexpression in MDA‐MB‐231 breast cancer cells Limited transcriptomic changes upon HOTAIR RNA overexpression.

Rab3a and SNARE Proteins: Potential Regulators of Melanosome Movement

Yuri Oleynikov, Robert H. Singer Current Biology

YAP1 and IGF2BP3 regulate each other during fetal programming.

Effectively regenerating livers transiently accumulate proliferative IGF2BP3-positive cells. Effectively regenerating livers transiently accumulate proliferative.

A Novel Gene Expressed in Human Keratinocytes with Long-Term In Vitro Growth Potential is Required for Cell Growth Laure Aurelian, Cynthia C. Smith,

Fig. 6 DMF inhibits NF-κB translocation upon infection.

Supplementary Figure 1 A B C SW620 HT29 SW620

Volume 41, Issue 5, Pages (November 2004)

Volume 67, Issue 2, Pages (February 2005)

Direct effects of dexamethasone on human podocytes

Suppression of VEGFR2 Expression in Human Endothelial Cells by Dimethylfumarate Treatment: Evidence for Anti-Angiogenic Action Markus Meissner, Monika.

Fig. 2. Ex vivo inducible knockout of PDCD2 in ESCs results in loss of S phase entry and increased p53.(A) Growth curve of inducible knockout and WT ESCs.

Volume 5, Issue 4, Pages (November 2013)

Fig. 4 Loss of Zic5 derepresses GLUT1/SLC2A1 gene expression.

Volume 3, Issue 1, Pages (January 2003)

AS1411 alters subcellular distribution of PRMT5 in a time-dependent, dose-dependent, and nucleolin-dependent manner. AS1411 alters subcellular distribution.

Effect of Healing on the Expression of Transforming Growth Factor βs and their Receptors in Chronic Venous Leg Ulcers Allison J. Cowin, Nicholas Hatzirodos,

Presentation transcript:

Supplementary Online Information

SOI Fig 1 Preliminary microarray data on dysregulation of angiogenic proteins by butyrate In a preliminary experiment, RNA was extracted from HCT116 cells grown in the presence (white bars) or absence (grey bars) of butyrate. Reverse transcribed and used to probe U133 arrays. Expression of genes linked to VEGF was sorted from the array data and indicated that both VEGF and NRP1 are down-regulated by butyrate.

SOI Fig 2 The distribution of NRP in HCT116 is heterogenous with cells carrying distributing NRP1 multiple ways. Larger field image of data presented in Fig 2 indicated the heterogeneity of expression of cells stained for NRP-1.

A iiiiii B iiiiii SOI Fig 3 The redistribution of NRP and VEGF in HCT116 following treatment with butyrate As few studies have reported the role or localisation of NRP-1 in epithelial cells or cell lines, we undertook an HCA analysis of NRP-1 in HCT116 cells (Panel A). The distribution of NRP-1 was very heterogenous (see supplementary Figure 3) and fell into three general types: pan-cytosolic; peri-nuclear or associated with an adjacent body or peripheral. The levels of NRP-1 in cells were quantified by HCA as total NRP-1 (Ai), and the amounts at the nuclear edge (Aii) and at the cytoplasmic membrane (Aiii). Following butyrate treatment there is a decrease in level of NRP-1 cross-reactivity in the cell as a whole and at both subcellular locations implying that there is no redistribution of NRP-1. These data are consistent with the findings from immunoblotting and qRT-PCR. VEGF levels and subcellular distribution were analysed by HCA. Subcellular distribution of VEGF was more homogenous in the cell population than NRP-1. Following treatment with butyrate staining intensity increased. Increase in cellular intensity of VEGF and subcellular localisation was quantified by HCA and in agreement with data from the western blotting. Data showing VEGF accumulation were highly significant for all events.

SOI Fig 4: Primers designed for amplification of targets Forward and reverse primers for PCR analysis of ligands and receptor expression, along with amplicon sizes are shown. TargetForward primerReverse primer Length (bp) VEGFAGGTCCCTCTTGGAATTGGATTGTATGTGGGTGGGTGTGTC115 VEGFBGACAGTGCTGTGAAGCCAGAAGTGGGATGGGTGATGTCAG120 VEGFCAGAGAACAGGCCAACCTCAATGGCATGCATTGAGTCTTTC120 VEGFR1TCCTTTGGATGAGCAGTGTGAGCCCCTCTTCCAAGTGATT100 VEGFR2CCAGTCAGAGACCCACGTTTTCCAGAATCCTCTTCCATGC123 VEGFR3CCACACAGAACTCTCCAGCAACAATGACCTCGGTGCTCTC120 NRP1CGTGGAAGTCTTCGATGGAGAAGAAATGGCCCTGAAGACA100 NRP2AAGTTCACCTCCGACTACGCGGAAACCCAGGAGATTCGAT131 HGFTGGCCATGAATTTGACCTCTGCTGACATTTGATGCCACTCT116 HGFRGTCAATTCAGCGAAGTCCTCGAAACCACAACCTGCATGA109 PDGFAACGAGATTCCTCGGAGTCAGCTTGACACTGCTCGTGTTGC110 PDGFBAGACCCCGGAGAGGAAGATGGAACCCAGGCTCCTTCTT106 PDGFRαCCAGGGAGGTCAAAGAAATGACTTCATGCAGGTTGACAGC109 PDGFRβGTGGTGATCTCAGCCATCCTCCTTCCATCGGATCTCGTAA106