Overview of Bioinformatics A/P Shoba Ranganathan Justin Choo National University of Singapore A Tutorial on Bioinformatics.

Slides:



Advertisements
Similar presentations
Pre-SIG meeting " Genome Annotation" A BioSapiens initiative Goal of the workshop were - to create an open forum to discuss current problems on function.
Advertisements

Basic Genomic Characteristic  AIM: to collect as much general information as possible about your gene: Nucleotide sequence Databases ○ NCBI GenBank ○
Peter Tsai, Bioinformatics Institute.  University of California, Santa Cruz (UCSC)  A rapid and reliable display of any requested portion of genomes.
Bioinformatics at WSU Matt Settles Bioinformatics Core Washington State University Wednesday, April 23, 2008 WSU Linux User Group (LUG)‏
Bioinformatics at IU - Ketan Mane. Bioinformatics at IU What is Bioinformatics? Bioinformatics is the study of the inherent structure of biological information.
Bio-bio-1 Team Advisor: Dr. Supten Sarbadhikari Members: Fokhruz Zaman Zohirul Alam Tiemoon Saddam Hossain Farjana Khatun.
Archives and Information Retrieval
Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.
JYC: CSM17 BioinformaticsCSM17 Week1:What is Bioinformatics? A Multidisciplinary Subject incorporating: Biology –the study of living systems Informatics.
Introduction to Genomics, Bioinformatics & Proteomics Brian Rybarczyk, PhD PMABS Department of Biology University of North Carolina Chapel Hill.
The Cell, Central Dogma and Human Genome Project.
Richard, Rochelle, Zohal, Angie
Modeling Functional Genomics Datasets CVM Lesson 1 13 June 2007Bindu Nanduri.
Signaling Pathways and Summary June 30, 2005 Signaling lecture Course summary Tomorrow Next Week Friday, 7/8/05 Morning presentation of writing assignments.
ExPASy - Expert Protein Analysis System The bioinformatics resource portal and other resources An Overview.
Michael Cummings David Reisman University of South Carolina Genomes and Genomics Chapter 15.
Paola CASTAGNOLI Maria FOTI Microarrays. Applicazioni nella genomica funzionale e nel genotyping DIPARTIMENTO DI BIOTECNOLOGIE E BIOSCIENZE.
Comparative Genomics of Viruses: VirGen as a case study Dr. Urmila Kulkarni-Kale Bioinformatics Centre University of Pune Pune
Bioinformatics Jan Taylor. A bit about me Biochemistry and Molecular Biology Computer Science, Computational Biology Multivariate statistics Machine learning.
Cédric Notredame (30/08/2015) Chemoinformatics And Bioinformatics Cédric Notredame Molecular Biology Bioinformatics Chemoinformatics Chemistry.
23 May June May 2002 From genes to drugs via crystallography 19 May 1996 Experimental and computational approaches to structure based.
Development of Bioinformatics and its application on Biotechnology
Erice 2008 Introduction to PDB Workshop From Molecules to Medicine: Integrating Crystallography in Drug Discovery Erice, 29 May - 8 June Peter Rose
AP Biology Ch. 20 Biotechnology.
CS 790 – Bioinformatics Introduction and overview.
Supporting bioinformatics education in the Asia-Pacific Shoba Ranganathan Professor and Chair – Bioinformatics Dept. of Chemistry and Biomolecular Sciences.
Function first: a powerful approach to post-genomic drug discovery Stephen F. Betz, Susan M. Baxter and Jacquelyn S. Fetrow GeneFormatics Presented by.
Biological Databases Biology outside the lab. Why do we need Bioinfomatics? Over the past few decades, major advances in the field of molecular biology,
REMINDERS 2 nd Exam on Nov.17 Coverage: Central Dogma of DNA Replication Transcription Translation Cell structure and function Recombinant DNA technology.
Gramene Objectives Provide researchers working on grasses and plants in general with a bird’s eye view of the grass genomes and their organization. Work.
Harbin Institute of Technology Computer Science and Bioinformatics Wang Yadong Second US-China Computer Science Leadership Summit.
Sackler Medical School
Biological Signal Detection for Protein Function Prediction Investigators: Yang Dai Prime Grant Support: NSF Problem Statement and Motivation Technical.
Mining Biological Data. Protein Enzymatic ProteinsTransport ProteinsRegulatory Proteins Storage ProteinsHormonal ProteinsReceptor Proteins.
Overview of Bioinformatics 1 Module Denis Manley..
Introduction to Bioinformatics Dr. Rybarczyk, PhD University of North Carolina-Chapel Hill
Bioinformatics MEDC601 Lecture by Brad Windle Ph# Office: Massey Cancer Center, Goodwin Labs Room 319 Web site for lecture:
Proteomics Session 1 Introduction. Some basic concepts in biology and biochemistry.
Epidemiology 217 Molecular and Genetic Epidemiology Bioinformatics & Proteomics John Witte.
Central dogma: the story of life RNA DNA Protein.
EB3233 Bioinformatics Introduction to Bioinformatics.
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
An overview of Bioinformatics. Cell and Central Dogma.
A collaborative tool for sequence annotation. Contact:
Bioinformatics and Computational Biology
EBI is an Outstation of the European Molecular Biology Laboratory. UniProtKB Sandra Orchard.
Biological Information and Biological Databases Meena K Sakharkar Bioinformatics Centre National University of Singapore.
Bioinformatics Dipl. Ing. (FH) Patrick Grossmann
PLANT BIOTECHNOLOGY & GENETIC ENGINEERING (3 CREDIT HOURS) LECTURE 13 ANALYSIS OF THE TRANSCRIPTOME.
UCSC Genome Browser Zeevik Melamed & Dror Hollander Gil Ast Lab Sackler Medical School.
Biotechnology and Bioinformatics: Bioinformatics Essential Idea: Bioinformatics is the use of computers to analyze sequence data in biological research.
RDF based on Integration of Pathway Database and Gene Ontology SNU OOPSLA LAB DongHyuk Im.
BME435 BIOINFORMATICS.
Biotechnology.
Bioinformatics Overview
Bioinformatics Madina Bazarova. What is Bioinformatics? Bioinformatics is marriage between biology and computer. It is the use of computers for the acquisition,
생물정보학 Bioinformatics.
New genes can be added to an organism’s DNA.
Genomes and Their Evolution
Genome organization and Bioinformatics
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Nancy Baker SILS Bioinformatics Seminar January 21, 2004
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
BIOINFORMATICS Summary
Important Points in Drug Design based on Bioinformatics Tools
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
SUBMITTED BY: DEEPTI SHARMA BIOLOGICAL DATABASE AND SEQUENCE ANALYSIS.
Presentation transcript:

Overview of Bioinformatics A/P Shoba Ranganathan Justin Choo National University of Singapore A Tutorial on Bioinformatics

What is Bioinformatics ? Bioinformatics is “the study of the information content and information flow in biological systems and processes”. - Michael Liebman in “Bioinformatics: An Editorial Perspective” ( Annotate -> store -> search/retrieve -> analyze -> visualize Nucleic acid sequence (genes and RNAs), protein sequence and structural information.

SARS & Its Implication...

SARS - Bioinformatics In Action

Sequencing Of SARS … Photo above shows the sequencing area of the lab. Taken from

Partial Sequence of SARS … >gi| |gb|AY | SARS coronavirus TOR2, complete genome ATATTAGGTTTTTACCTACCCAGGAAAAGCCAACCAACCTCGATCTCTTGTAGATCTGTTCTCTAAACGA ACTTTAAAATCTGTGTAGCTGTCGCTCGGCTGCATGCCTAGTGCACCTACGCAGTATAAACAATAATAAA TTTTACTGTCGTTGACAAGAAACGAGTAACTCGTCCCTCTTCTGCAGACTGCTTACGGTTTCGTCCGTGT TGCAGTCGATCATCAGCATACCTAGGTTTCGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTTC TTGGTGTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTCCTTCAGGTTAGAGACGTGCTAGTGCG TGGCTTCGGGGACTCTGTGGAAGAGGCCCTATCGGAGGCACGTGAACACCTCAAAAATGGCACTTGTGGT CTAGTAGAGCTGGAAAAAGGCGTACTGCCCCAGCTTGAACAGCCCTATGTGTTCATTAAACGTTCTGATG CCTTAAGCACCAATCACGGCCACAAGGTCGTTGAGCTGGTTGCAGAAATGGACGGCATTCAGTACGGTCG TAGCGGTATAACACTGGGAGTACTCGTGCCACATGTGGGCGAAACCCCAATTGCATACCGCAATGTTCTT CTTCGTAAGAACGGTAATAAGGGAGCCGGTGGTCATAGCTATGGCATCGATCTAAAGTCTTATGACTTAG GTGACGAGCTTGGCACTGATCCCATTGAAGATTATGAACAAAACTGGAACACTAAGCATGGCAGTGGTGC ACTCCGTGAACTCACTCGTGAGCTCAATGGAGGTGCAGTCACTCGCTATGTCGACAACAATTTCTGTGGC CCAGATGGGTACCCTCTTGATTGCATCAAAGATTTTCTCGCACGCGCGGGCAAGTCAATGTGCACTCTTT CCGAACAACTTGATTACATCGAGTCGAAGAGAGGTGTCTACTGCTGCCGTGACCATGAGCATGAAATTGC CTGGTTCACTGAGCGCTCTGATAAGAGCTACGAGCACCAGACACCCTTCGAAATTAAGAGTGCCAAGAAA TTTGACACTTTCAAAGGGGAATGCCCAAAGTTTGTGTTTCCTCTTAACTCAAAAGTCAAAGTCATTCAAC CACGTGTTGAAAAGAAAAAGACTGAGGGTTTCATGGGGCGTATACGCTCTGTGTACCCTGTTGCATCTCC ACAGGAGTGTAACAATATGCACTTGTCTACCTTGATGAAATGTAATCATTGCGATGAAGTTTCATGGCAG ACGTGCGACTTTCTGAAAGCCACTTGTGAACATTGTGGCACTGAAAATTTAGTTATTGAAGGACCTACTA The complete genome of SARS, obtained from

Bioinformatics -Timeline Single Structures Modeling & Geometry Forces & Simulation Docking Sequences, Sequence-Structure Relationships Alignment Structure Prediction Fold recognition Genomics Dealing with many sequences Gene finding & Genome Annotation Databases Integrative Analysis Expression & Proteomics Data Data mining Simulation again…(whole cells?).

Biological Databases Collect, organise and classify data Query the dataset Retrieve entries based on keyword search Genbank PDB EMBL

Sequence Analysis Software What is the information contained in a biological sequence? How can we analyse it to gain knowledge? Does it contain any functional clues?

Sequence Comparison How can we compare a given sequence to the millions in the database? Which ones are truly related by evolution? What can the study of related sequences tell us?

Sequence Alignment After collecting a set of related sequences, how can we compare them as a set? How should we line up the sequences so that the most similar portions are together? What do we do with sequences of different lengths?

Protein Structure The function of a protein is a consequence of its folded state: Anfinsen, 1961 The 3D fold of a protein is called its structure In 3D, the business end of the protein has contributions from different regions of its sequence Picture taken from

Visualization Using graphic tools to view structures Simple commands to analyse structures and active sites Different graphic representations and colouring schemes Picture taken from

Careers in Bioinformatics Genomics: Genome sequencing of –Bacteria, viruses –Animals –Plants Comparative genomics Annotation and Mapping Gene Discovery

Careers in Bioinformatics Functional Genomics (Gene Expression and Regulation): Control Regions –Switches –Circuits –Bypass –Feedback loops Environmental Effects Diseased States Chemical Consequences

Careers in Bioinformatics Pharmacogenomics: SNPs –Regional, ethnic variations –Inheritance patterns –Radiological/ecological modifications Therapeutic target recognition Correlation of drug and expression effects Pathway Effects

Careers in Bioinformatics Proteomics: Protein Profiling –Alternate splice variants –Orphan genes –Cryptic introns Gene Therapy

Careers in Bioinformatics Structural Genomics: Experimental Protein structures –Apo state –Holo state –Structural modifications Membrane Proteins Homology Modelling Comparative Modelling

Careers in Bioinformatics Drug and Vaccine Design: Screening Natural Products –Plants –Fungi –Bacteria Chemicals In silico modifications of ligands Vaccine design and delivery

Job Sectors Academia Research Institutes Biotechnology Bioinformatics Pharmaceutical Agriculture Biodiversity

The End