Harvard iGEM 2006 Cyanobacterial Oscillator From cyanobacteria......to E. coli Photosynthetic Circadian rhythm Evolved over billions of years Model organism.

Slides:



Advertisements
Similar presentations
Harvard iGEM 2006 Cyanobacterial Oscillator Hetmann Hsieh Jeff Lau Dave Ramos Zhipeng Sun Harvard iGEM 2006 Creating a robust biological oscillating biobrick.
Advertisements

Week 8. Outline Project Goal Extracting and biobricking KaiA and KaiB Synthesis update Western Blotting update Site-Specific Mutagenesis update Promoter.
Combinatorial Synthesis of Genetic Networks Guet et. al. Andrew Goodrich Charles Feng.
MCB 186 CIRCADIAN BIOLOGY The cellular-molecular mechanism of the circadian clock CLOCK MUTANTS Lecture #4 October 18, 2006 J. W. Hastings.
Cyanobacterial Oscillator in E. coli Why care about biological oscillators in the first place? Bio-oscillators have a number of potential applications:
Mukund Thattai NCBS Bangalore genetic networks in theory and practice.
A Synthetic Biology Approach to Discerning Circadian Output Pathways in Cyanobacteria Zhipeng Sun MCB186 Final Project December 13, 2006.
CYANOBACTERIA CLOCK MCB 186 CIRCADIAN BIOLOGY December 13, 2006 Hetmann Hsieh Proposal to Determine the Posttranslational Effect of Circadian Clock–Resetting.
MCB 186 CIRCADIAN BIOLOGY Slides Lecture 3 Clock genes & Biochemical Mechanisms October 5, 2005 J. W. Hastings.
What Is the Mechanism of the Cyanobacterial Circadian Oscillator? Mike Rust O’Shea Group 10/10/2007 MCB 186 CIRCADIAN BIOLOGY.
Oscillatory Systems Jesse Wu Outline What is an oscillator? Types of oscillators Oscillator related things to think about.
Synthetic Biology Crash Course DAY ONE. Pre-Assessment 1:00-1:10.
Designing, Building, and Using DNA Nanoboxes: - Inside-Outside Specific Protection of Sites - Tiffany Chan - Harvard International Genetically Engineered.
Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.
Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.
MCB 186 CIRCADIAN BIOLOGY Clock genes & Biochemical Mechanisms: Kai genes October 10, 2007 J. W. Hastings.
Information in Biology. Outline What is synthetic biology? Biological Clocks The “Repressilator” Signal transduction The “Diverter”
Week 4: Eureka!. Phone conversation with Professor Susan Golden at Texas A&M: Professor Golden is one of the leading experts in cyanobacteria and has.
The robust ticking of a circadian clock David Zwicker, Jeroen van Zon,David Lubensky, Pim Altena, Pieter Rein ten Wolde Beijing, July 27, 2010 Synechococcus.
Taattcgcggccgcttctagagattgtgagcggataacaattgacattgtgagcggataacaagatactgagcactactagagaaagaggagaaatactagatgactataatgataaaaaaat cggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactc.
Harvard iGEM 2007 Introduction Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry.
Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.
Circadian rhythm March tongli zhang. Circadian rhythm.
Protein delivery: DNA nanostructures and cell-surface targeting Harvard iGEM August 27, 2006.
Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.
Harvard iGEM 2006 Cyanobacterial Oscillator From cyanobacteria......to E. coli Photosynthetic Circadian rhythm Evolved over billions of years Model organism.
Week 5. 1.Create KaiA and KaiBC biobricks. 2.Transform E. coli with Kai Biobricks to reconstitute KaiC phosphorylation cycle with no reporter attached.
Week 9 review Cyanobacteria Oscillator in E. coli.
PowerPoint Slides for Chapter 16: Emergent Properties at the Molecular Level by A. Malcolm Campbell, Laurie J. Heyer, and Chris Paradise Title Page Integrating.
Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.
The little oscillator that could. and could…
Week 7 review Cyanobacteria Oscillator in E. coli.
Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.
Week 6. Outline Background Information Update: new paper out July 21 st Experimental Progress Current challenges Bad template Successful colony PCR (try.
Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.
Hetmann Hsieh Jeffrey Lau David Ramos Zhipeng Sun.
Designing DNA Nanostructures to encapsulate and release proteins iGEM August 21, 2006 Katherine Fifer with Valerie Lau, Matthew Meisel, and Tiffany Chan.
The little oscillator that could. and could…
Harvard iGEM 2006 Cyanobacterial Oscillator Hetmann Hsieh Jeff Lau Dave Ramos Zhipeng Sun Harvard iGEM 2006 Creating a robust oscillator BioBrick.
Harvard iGEM 2006 Cyanobacterial Oscillator Hetmann Hsieh Jeff Lau Dave Ramos Zhipeng Sun Harvard iGEM 2006 Creating a robust biological oscillating biobrick.
Cling-E. coli : Bacteria on target
Harvard iGEM 2006 Week 3 Peng, David, Jeff, Hetmann
Harvard iGEM 2006.
Cling-E. coli : Bacteria on target
Cyanobacteria Oscillator
A Cyanobacterial Circadian Clockwork
The ΔrlmA mutant strain has impaired CWI pathway activation.
Gopal K. Pattanayak, Guillaume Lambert, Kevin Bernat, Michael J. Rust 
Cyanobacterial Oscillator
Virginia iGEM Workshop #2 High School Education Series.
Andrian Gutu, Erin K. O’Shea  Molecular Cell 
Cling-E. coli : Bacteria on target
Cyanobacterial Oscillator
Cling-E. coli : Bacteria on target
Cling-E. coli : Bacteria on target
Week 4: Eureka!.
Dynamic Localization of the Cyanobacterial Circadian Clock Proteins
Cyanobacterial Oscillator
Protein delivery: DNA nanostructures and cell-surface targeting
Cyanobacterial Oscillator
Cyanobacterial Oscillator
Cyanobacterial Oscillator
Cyanobacterial Oscillator
Volume 23, Issue 2, Pages (July 2006)
Cyanobacteria Oscillator
Frequencies and levels of Venus expression after transformation of Chlamydomonas with various constructs. Frequencies and levels of Venus expression after.
Stability of SsbA (A) and GFP (B) proteins in UA159 and ΔclpX strains.
Welcome to iGEM 2007!.
Transplantability of a circadian clock to a noncircadian organism
Expression of MtrE by wild-type and mtr120 mutant strains.
Presentation transcript:

Harvard iGEM 2006 Cyanobacterial Oscillator From cyanobacteria......to E. coli Photosynthetic Circadian rhythm Evolved over billions of years Model organism for synthetic biology BioBrick registry

Harvard iGEM 2006 Cyanobacterial Oscillator Time Applications of a Bio-oscillator hu -Clock -Nightlight -Timed drug delivery -Bio-circuitry -Scientific research

Harvard iGEM 2006 Cyanobacterial Oscillator The Repressilator Our Bio-oscillator Lac Λ- cI Tet Time Fluorescence Elowitz et al. 2000

Harvard iGEM 2006 Cyanobacterial Oscillator PP P P P P The Kai Clock in Cyanobacteria KaiC autophosphorylates and dephosphorylates KaiA promotes phosphorylation KaiB inhibits KaiA Time Phosphorylation of KaiC

Harvard iGEM 2006 Cyanobacterial Oscillator Project Goals Reconstitute the cyanobacteria Kai oscillator in E. coli 1.Create KaiA, KaiB, and KaiC BioBricks. 2.Combine the above with promoters, etc. to form functional BioBricks. 3.Express Kai proteins in E. coli and verify interaction. 4.Verify oscillation in E. coli.

Harvard iGEM 2006 Cyanobacterial Oscillator Results: Construct Creation We’ve made the following constructs: Kai genes Lac promoter + Kai genes KaiA + KaiC and KaiB + KaiC (with promoters)

Harvard iGEM 2006 Cyanobacterial Oscillator PP P P P P Results: Protein Interaction

Harvard iGEM 2006 Cyanobacterial Oscillator Results: Protein Interaction Constructs were transformed in E. coli Cultures were grown overnight Western blot was washed with anti-KaiC antibodies (courtesy of Susan Golden) The gel was imaged, producing the above results containing phosphorylated and unphosphorylated KaiC Western blot Image Anti-KaiC antibodies

Harvard iGEM 2006 Cyanobacterial Oscillator Results: Protein Interaction Western blot results Anti-KaiC antibodies PP P P P P

Harvard iGEM 2006 Cyanobacterial Oscillator Results: Protein Interaction Western blot results (interaction experiment) Anti-KaiC antibodies PP P P P P

Harvard iGEM 2006 Cyanobacterial Oscillator Results: Protein Interaction Western blot results (interaction experiment) Anti-KaiC antibodies PP P P P P

Harvard iGEM 2006 Cyanobacterial Oscillator Results: Protein Interaction Western blot results (interaction experiment) Anti-KaiC antibodies PP P P P P

Harvard iGEM 2006 Cyanobacterial Oscillator Future work Verify oscillation in E. coli. Synchronization problem Within cell Between cells Solution: Pulsed expression of Kai genes

Harvard iGEM 2006 Cyanobacterial Oscillator Future work Verify oscillation in E. coli. Synchronization problem Within cell Between cells Solution: Pulsed expression of Kai genes

Harvard iGEM 2006 Cyanobacterial Oscillator Acknowledgements Our teaching fellows Chris Doucette, Shawn Douglas, and Nick Stroustrup for their valuable help in lab Profs. Alain Viel, George Church, Pam Silver, William Shih, Radhika Nagpal, and Jagesh Shah Prof. Susan Golden at Texas A&M for providing anti- KaiC antibodies and advice Peter MIT and Eric WHOI for cyanobacteria strains